Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1206604650:

Variant ID: vg1206604650 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 6604650
Reference Allele: A	Alternative Allele: T,C
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.61, T: 0.39, others allele: 0.00, population size: 57. )

Flanking Sequence (100 bp) in Reference Genome:

CCAACTTCACGAAATTCACAGATGAGAATGCTATGACTACAATGGAGCATATCGGCCGCTTTATTGATCAATGTGGTAAGGCTGGTAGCGATGATTTGCT[A/T,C]
AAGTTGAAGTTGTTTCCCCTTTCTTTGTCAAACTTTGCATCTACATGGTATAGTTTACTTGCTCCTAATTCAATTTCTACATGGTTACAAATGAAGCATG

Reverse complement sequence

CATGCTTCATTTGTAACCATGTAGAAATTGAATTAGGAGCAAGTAAACTATACCATGTAGATGCAAAGTTTGACAAAGAAAGGGGAAACAACTTCAACTT[T/A,G]
AGCAAATCATCGCTACCAGCCTTACCACATTGATCAATAAAGCGGCCGATATGCTCCATTGTAGTCATAGCATTCTCATCTGTGAATTTCGTGAAGTTGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.30%	38.40%	12.08%	3.09%	C: 0.17%
All Indica	2759	19.50%	58.20%	18.63%	3.52%	C: 0.22%
All Japonica	1512	95.00%	0.90%	1.06%	3.04%	NA
Aus	269	49.80%	39.00%	10.04%	0.37%	C: 0.74%
Indica I	595	44.40%	37.50%	15.63%	2.52%	NA
Indica II	465	10.10%	50.80%	31.40%	7.53%	C: 0.22%
Indica III	913	5.40%	79.20%	12.92%	2.30%	C: 0.22%
Indica Intermediate	786	22.50%	53.80%	19.97%	3.31%	C: 0.38%
Temperate Japonica	767	96.10%	0.30%	1.17%	2.48%	NA
Tropical Japonica	504	92.30%	1.40%	1.19%	5.16%	NA
Japonica Intermediate	241	97.10%	2.10%	0.41%	0.41%	NA
VI/Aromatic	96	19.80%	76.00%	4.17%	0.00%	NA
Intermediate	90	66.70%	20.00%	11.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1206604650	A -> C	LOC_Os12g12060.1	downstream_gene_variant ; 3915.0bp to feature; MODIFIER	silent_mutation	Average:9.135; most accessible tissue: Zhenshan97 root, score: 12.891	N	N	N	N
vg1206604650	A -> C	LOC_Os12g12040-LOC_Os12g12060	intergenic_region ; MODIFIER	silent_mutation	Average:9.135; most accessible tissue: Zhenshan97 root, score: 12.891	N	N	N	N
vg1206604650	A -> DEL	N	N	silent_mutation	Average:9.135; most accessible tissue: Zhenshan97 root, score: 12.891	N	N	N	N
vg1206604650	A -> T	LOC_Os12g12060.1	downstream_gene_variant ; 3915.0bp to feature; MODIFIER	silent_mutation	Average:9.135; most accessible tissue: Zhenshan97 root, score: 12.891	N	N	N	N
vg1206604650	A -> T	LOC_Os12g12040-LOC_Os12g12060	intergenic_region ; MODIFIER	silent_mutation	Average:9.135; most accessible tissue: Zhenshan97 root, score: 12.891	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1206604650	NA	5.76E-18	mr1253	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206604650	NA	2.39E-09	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206604650	NA	2.64E-06	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206604650	4.41E-06	NA	mr1363_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206604650	NA	1.06E-19	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251