Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206398865:

Variant ID: vg1206398865 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 6398865
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.79, T: 0.21, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


CACAGGAAATTATGGCGAAATATAGTTGGACCCAACCTTGTCACACACGCAACTAGTTAGACACAATTCCACCCGTTGTTGGATATCCAGTTGGCTGTAC[T/A]
TTTCACTTAAAGGGAGGAATGAAGCAAGCGCGATGTTTCTTCGTTGTTAAGGTAATATTACTAATATGGAGTATATATAATATTGATTATTACAGAATTA

Reverse complement sequence

TAATTCTGTAATAATCAATATTATATATACTCCATATTAGTAATATTACCTTAACAACGAAGAAACATCGCGCTTGCTTCATTCCTCCCTTTAAGTGAAA[A/T]
GTACAGCCAACTGGATATCCAACAACGGGTGGAATTGTGTCTAACTAGTTGCGTGTGTGACAAGGTTGGGTCCAACTATATTTCGCCATAATTTCCTGTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.70% 13.50% 0.23% 59.61% NA
All Indica  2759 36.20% 2.40% 0.14% 61.18% NA
All Japonica  1512 8.90% 34.20% 0.46% 56.42% NA
Aus  269 5.60% 14.50% 0.00% 79.93% NA
Indica I  595 85.90% 5.90% 0.17% 8.07% NA
Indica II  465 19.40% 1.50% 0.22% 78.92% NA
Indica III  913 12.40% 0.40% 0.11% 87.08% NA
Indica Intermediate  786 36.40% 2.70% 0.13% 60.81% NA
Temperate Japonica  767 15.90% 37.90% 0.52% 45.63% NA
Tropical Japonica  504 1.00% 21.00% 0.20% 77.78% NA
Japonica Intermediate  241 3.30% 49.80% 0.83% 46.06% NA
VI/Aromatic  96 78.10% 1.00% 0.00% 20.83% NA
Intermediate  90 38.90% 15.60% 0.00% 45.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1206398865 T -> DEL N N silent_mutation Average:76.912; most accessible tissue: Zhenshan97 root, score: 88.318 N N N N
vg1206398865 T -> A LOC_Os12g11790.1 upstream_gene_variant ; 4611.0bp to feature; MODIFIER silent_mutation Average:76.912; most accessible tissue: Zhenshan97 root, score: 88.318 N N N N
vg1206398865 T -> A LOC_Os12g11800.1 upstream_gene_variant ; 1421.0bp to feature; MODIFIER silent_mutation Average:76.912; most accessible tissue: Zhenshan97 root, score: 88.318 N N N N
vg1206398865 T -> A LOC_Os12g11790-LOC_Os12g11800 intergenic_region ; MODIFIER silent_mutation Average:76.912; most accessible tissue: Zhenshan97 root, score: 88.318 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1206398865 T A -0.39 -0.18 -0.11 -0.06 -0.14 -0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1206398865 NA 6.01E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206398865 NA 2.92E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206398865 NA 7.01E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206398865 NA 6.33E-06 mr1204_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206398865 NA 4.11E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206398865 NA 6.55E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206398865 9.51E-07 8.96E-10 mr1555_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206398865 NA 5.11E-06 mr1555_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206398865 NA 4.91E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206398865 NA 7.10E-06 mr1965_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206398865 4.08E-06 7.90E-08 mr1982_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251