\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206397770:

Variant ID: vg1206397770 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 6397770
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


AGCATTTTCCACGCTAGGGTCCTGTTTGAAAGATTAGCCCAGGGCTAATTTTGAGGGGTAATGTTTAGTCATGAATTGGTAGGCTAAACATTAGCCTAGG[G/A]
TAGCATGTTTGGATCCATGGGCTAAATCAAGTCTAAAAGGTGGAGAGAAAGTAGAAAGAGAGGAGAGAGAATGAGAGAGAGCTGCATTTGATGGTCCCCA

Reverse complement sequence

TGGGGACCATCAAATGCAGCTCTCTCTCATTCTCTCTCCTCTCTTTCTACTTTCTCTCCACCTTTTAGACTTGATTTAGCCCATGGATCCAAACATGCTA[C/T]
CCTAGGCTAATGTTTAGCCTACCAATTCATGACTAAACATTACCCCTCAAAATTAGCCCTGGGCTAATCTTTCAAACAGGACCCTAGCGTGGAAAATGCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.50% 15.80% 0.53% 59.18% NA
All Indica  2759 35.20% 3.30% 0.25% 61.18% NA
All Japonica  1512 5.60% 38.20% 1.12% 55.03% NA
Aus  269 2.20% 18.20% 0.37% 79.18% NA
Indica I  595 85.50% 6.20% 0.17% 8.07% NA
Indica II  465 18.70% 1.90% 0.22% 79.14% NA
Indica III  913 10.80% 2.10% 0.33% 86.75% NA
Indica Intermediate  786 35.20% 3.40% 0.25% 61.07% NA
Temperate Japonica  767 9.60% 45.10% 1.30% 43.94% NA
Tropical Japonica  504 1.00% 22.00% 0.60% 76.39% NA
Japonica Intermediate  241 2.50% 50.20% 1.66% 45.64% NA
VI/Aromatic  96 68.80% 10.40% 0.00% 20.83% NA
Intermediate  90 32.20% 18.90% 0.00% 48.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1206397770 G -> DEL N N silent_mutation Average:59.961; most accessible tissue: Callus, score: 87.944 N N N N
vg1206397770 G -> A LOC_Os12g11790.1 upstream_gene_variant ; 3516.0bp to feature; MODIFIER silent_mutation Average:59.961; most accessible tissue: Callus, score: 87.944 N N N N
vg1206397770 G -> A LOC_Os12g11800.1 upstream_gene_variant ; 2516.0bp to feature; MODIFIER silent_mutation Average:59.961; most accessible tissue: Callus, score: 87.944 N N N N
vg1206397770 G -> A LOC_Os12g11790-LOC_Os12g11800 intergenic_region ; MODIFIER silent_mutation Average:59.961; most accessible tissue: Callus, score: 87.944 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1206397770 7.89E-06 3.95E-09 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206397770 NA 1.13E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206397770 NA 2.27E-07 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206397770 NA 5.49E-06 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206397770 NA 3.00E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206397770 3.72E-08 NA mr1549_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206397770 NA 7.99E-07 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206397770 NA 9.07E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206397770 2.24E-07 NA mr1757_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206397770 1.89E-06 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206397770 7.98E-06 1.03E-07 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251