Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206396445:

Variant ID: vg1206396445 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 6396445
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, G: 0.12, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:

TTGTTCAGATTATCATATTTCAACAAAAACCACTGCAATATGCAAAAATCTTTATGATCCCGCATTTTGGTACTAATGATGGATGAAAAAAATGGATGAT[A/G]
AACGATGACACAAAGAATTTTCTATATATAGATAGTGATGATATTCCTTAAATATTTTCTAAGTTTGAAATAACTCTAACCATTATTAATATTGTTTTCA

Reverse complement sequence

TGAAAACAATATTAATAATGGTTAGAGTTATTTCAAACTTAGAAAATATTTAAGGAATATCATCACTATCTATATATAGAAAATTCTTTGTGTCATCGTT[T/C]
ATCATCCATTTTTTTCATCCATCATTAGTACCAAAATGCGGGATCATAAAGATTTTTGCATATTGCAGTGGTTTTTGTTGAAATATGATAATCTGAACAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.70%	15.60%	0.08%	59.63%	NA
All Indica	2759	35.30%	3.30%	0.04%	61.36%	NA
All Japonica	1512	5.80%	38.00%	0.13%	56.02%	NA
Aus	269	3.00%	17.10%	0.37%	79.55%	NA
Indica I	595	85.70%	6.10%	0.00%	8.24%	NA
Indica II	465	18.70%	1.90%	0.00%	79.35%	NA
Indica III	913	10.80%	2.00%	0.00%	87.19%	NA
Indica Intermediate	786	35.50%	3.40%	0.13%	60.94%	NA
Temperate Japonica	767	10.00%	44.50%	0.00%	45.50%	NA
Tropical Japonica	504	1.00%	21.80%	0.40%	76.79%	NA
Japonica Intermediate	241	2.50%	51.50%	0.00%	46.06%	NA
VI/Aromatic	96	68.80%	10.40%	0.00%	20.83%	NA
Intermediate	90	32.20%	18.90%	0.00%	48.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1206396445	A -> DEL	N	N	silent_mutation	Average:29.537; most accessible tissue: Callus, score: 60.518	N	N	N	N
vg1206396445	A -> G	LOC_Os12g11780.1	upstream_gene_variant ; 4501.0bp to feature; MODIFIER	silent_mutation	Average:29.537; most accessible tissue: Callus, score: 60.518	N	N	N	N
vg1206396445	A -> G	LOC_Os12g11790.1	upstream_gene_variant ; 2191.0bp to feature; MODIFIER	silent_mutation	Average:29.537; most accessible tissue: Callus, score: 60.518	N	N	N	N
vg1206396445	A -> G	LOC_Os12g11800.1	upstream_gene_variant ; 3841.0bp to feature; MODIFIER	silent_mutation	Average:29.537; most accessible tissue: Callus, score: 60.518	N	N	N	N
vg1206396445	A -> G	LOC_Os12g11790-LOC_Os12g11800	intergenic_region ; MODIFIER	silent_mutation	Average:29.537; most accessible tissue: Callus, score: 60.518	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1206396445	NA	1.52E-07	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206396445	NA	1.57E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206396445	NA	1.04E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206396445	NA	1.76E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206396445	8.58E-06	NA	mr1549_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206396445	NA	4.93E-07	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206396445	NA	1.02E-07	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206396445	9.52E-07	NA	mr1757_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206396445	5.82E-06	7.94E-08	mr1982_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251