\
| Variant ID: vg1206396445 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 6396445 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, G: 0.12, others allele: 0.00, population size: 69. )
TTGTTCAGATTATCATATTTCAACAAAAACCACTGCAATATGCAAAAATCTTTATGATCCCGCATTTTGGTACTAATGATGGATGAAAAAAATGGATGAT[A/G]
AACGATGACACAAAGAATTTTCTATATATAGATAGTGATGATATTCCTTAAATATTTTCTAAGTTTGAAATAACTCTAACCATTATTAATATTGTTTTCA
TGAAAACAATATTAATAATGGTTAGAGTTATTTCAAACTTAGAAAATATTTAAGGAATATCATCACTATCTATATATAGAAAATTCTTTGTGTCATCGTT[T/C]
ATCATCCATTTTTTTCATCCATCATTAGTACCAAAATGCGGGATCATAAAGATTTTTGCATATTGCAGTGGTTTTTGTTGAAATATGATAATCTGAACAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 24.70% | 15.60% | 0.08% | 59.63% | NA |
| All Indica | 2759 | 35.30% | 3.30% | 0.04% | 61.36% | NA |
| All Japonica | 1512 | 5.80% | 38.00% | 0.13% | 56.02% | NA |
| Aus | 269 | 3.00% | 17.10% | 0.37% | 79.55% | NA |
| Indica I | 595 | 85.70% | 6.10% | 0.00% | 8.24% | NA |
| Indica II | 465 | 18.70% | 1.90% | 0.00% | 79.35% | NA |
| Indica III | 913 | 10.80% | 2.00% | 0.00% | 87.19% | NA |
| Indica Intermediate | 786 | 35.50% | 3.40% | 0.13% | 60.94% | NA |
| Temperate Japonica | 767 | 10.00% | 44.50% | 0.00% | 45.50% | NA |
| Tropical Japonica | 504 | 1.00% | 21.80% | 0.40% | 76.79% | NA |
| Japonica Intermediate | 241 | 2.50% | 51.50% | 0.00% | 46.06% | NA |
| VI/Aromatic | 96 | 68.80% | 10.40% | 0.00% | 20.83% | NA |
| Intermediate | 90 | 32.20% | 18.90% | 0.00% | 48.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1206396445 | A -> DEL | N | N | silent_mutation | Average:29.537; most accessible tissue: Callus, score: 60.518 | N | N | N | N |
| vg1206396445 | A -> G | LOC_Os12g11780.1 | upstream_gene_variant ; 4501.0bp to feature; MODIFIER | silent_mutation | Average:29.537; most accessible tissue: Callus, score: 60.518 | N | N | N | N |
| vg1206396445 | A -> G | LOC_Os12g11790.1 | upstream_gene_variant ; 2191.0bp to feature; MODIFIER | silent_mutation | Average:29.537; most accessible tissue: Callus, score: 60.518 | N | N | N | N |
| vg1206396445 | A -> G | LOC_Os12g11800.1 | upstream_gene_variant ; 3841.0bp to feature; MODIFIER | silent_mutation | Average:29.537; most accessible tissue: Callus, score: 60.518 | N | N | N | N |
| vg1206396445 | A -> G | LOC_Os12g11790-LOC_Os12g11800 | intergenic_region ; MODIFIER | silent_mutation | Average:29.537; most accessible tissue: Callus, score: 60.518 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1206396445 | NA | 1.52E-07 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206396445 | NA | 1.57E-06 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206396445 | NA | 1.04E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206396445 | NA | 1.76E-06 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206396445 | 8.58E-06 | NA | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206396445 | NA | 4.93E-07 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206396445 | NA | 1.02E-07 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206396445 | 9.52E-07 | NA | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206396445 | 5.82E-06 | 7.94E-08 | mr1982_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |