\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206396445:

Variant ID: vg1206396445 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 6396445
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, G: 0.12, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTTCAGATTATCATATTTCAACAAAAACCACTGCAATATGCAAAAATCTTTATGATCCCGCATTTTGGTACTAATGATGGATGAAAAAAATGGATGAT[A/G]
AACGATGACACAAAGAATTTTCTATATATAGATAGTGATGATATTCCTTAAATATTTTCTAAGTTTGAAATAACTCTAACCATTATTAATATTGTTTTCA

Reverse complement sequence

TGAAAACAATATTAATAATGGTTAGAGTTATTTCAAACTTAGAAAATATTTAAGGAATATCATCACTATCTATATATAGAAAATTCTTTGTGTCATCGTT[T/C]
ATCATCCATTTTTTTCATCCATCATTAGTACCAAAATGCGGGATCATAAAGATTTTTGCATATTGCAGTGGTTTTTGTTGAAATATGATAATCTGAACAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.70% 15.60% 0.08% 59.63% NA
All Indica  2759 35.30% 3.30% 0.04% 61.36% NA
All Japonica  1512 5.80% 38.00% 0.13% 56.02% NA
Aus  269 3.00% 17.10% 0.37% 79.55% NA
Indica I  595 85.70% 6.10% 0.00% 8.24% NA
Indica II  465 18.70% 1.90% 0.00% 79.35% NA
Indica III  913 10.80% 2.00% 0.00% 87.19% NA
Indica Intermediate  786 35.50% 3.40% 0.13% 60.94% NA
Temperate Japonica  767 10.00% 44.50% 0.00% 45.50% NA
Tropical Japonica  504 1.00% 21.80% 0.40% 76.79% NA
Japonica Intermediate  241 2.50% 51.50% 0.00% 46.06% NA
VI/Aromatic  96 68.80% 10.40% 0.00% 20.83% NA
Intermediate  90 32.20% 18.90% 0.00% 48.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1206396445 A -> DEL N N silent_mutation Average:29.537; most accessible tissue: Callus, score: 60.518 N N N N
vg1206396445 A -> G LOC_Os12g11780.1 upstream_gene_variant ; 4501.0bp to feature; MODIFIER silent_mutation Average:29.537; most accessible tissue: Callus, score: 60.518 N N N N
vg1206396445 A -> G LOC_Os12g11790.1 upstream_gene_variant ; 2191.0bp to feature; MODIFIER silent_mutation Average:29.537; most accessible tissue: Callus, score: 60.518 N N N N
vg1206396445 A -> G LOC_Os12g11800.1 upstream_gene_variant ; 3841.0bp to feature; MODIFIER silent_mutation Average:29.537; most accessible tissue: Callus, score: 60.518 N N N N
vg1206396445 A -> G LOC_Os12g11790-LOC_Os12g11800 intergenic_region ; MODIFIER silent_mutation Average:29.537; most accessible tissue: Callus, score: 60.518 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1206396445 NA 1.52E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206396445 NA 1.57E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206396445 NA 1.04E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206396445 NA 1.76E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206396445 8.58E-06 NA mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206396445 NA 4.93E-07 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206396445 NA 1.02E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206396445 9.52E-07 NA mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206396445 5.82E-06 7.94E-08 mr1982_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251