\
| Variant ID: vg1206348060 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 6348060 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.63, T: 0.36, others allele: 0.00, population size: 76. )
ATAGCGGCAGTCCCGGTTGGTCACTATTTTTTTTCTTTTTTTATTGTTTCTTTGCTCACTACATTTTGCTTTTCCAAATCGAGTTGCTCCCTACATATCC[C/T]
TAAATCATCCACAAATCAAAGTAGCATCACAGATCATAGATTCACATCACAAATTCTCAAAAAAAAATACAACACAAATCAAATACATCACACATTATAT
ATATAATGTGTGATGTATTTGATTTGTGTTGTATTTTTTTTTGAGAATTTGTGATGTGAATCTATGATCTGTGATGCTACTTTGATTTGTGGATGATTTA[G/A]
GGATATGTAGGGAGCAACTCGATTTGGAAAAGCAAAATGTAGTGAGCAAAGAAACAATAAAAAAAGAAAAAAAATAGTGACCAACCGGGACTGCCGCTAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 24.50% | 15.10% | 0.25% | 60.22% | NA |
| All Indica | 2759 | 35.20% | 3.30% | 0.11% | 61.40% | NA |
| All Japonica | 1512 | 5.40% | 37.30% | 0.60% | 56.68% | NA |
| Aus | 269 | 2.60% | 15.60% | 0.00% | 81.78% | NA |
| Indica I | 595 | 85.40% | 6.10% | 0.00% | 8.57% | NA |
| Indica II | 465 | 18.70% | 1.30% | 0.00% | 80.00% | NA |
| Indica III | 913 | 10.80% | 2.40% | 0.22% | 86.53% | NA |
| Indica Intermediate | 786 | 35.40% | 3.30% | 0.13% | 61.20% | NA |
| Temperate Japonica | 767 | 9.40% | 43.40% | 0.65% | 46.54% | NA |
| Tropical Japonica | 504 | 1.00% | 22.20% | 0.40% | 76.39% | NA |
| Japonica Intermediate | 241 | 2.10% | 49.40% | 0.83% | 47.72% | NA |
| VI/Aromatic | 96 | 68.80% | 1.00% | 0.00% | 30.21% | NA |
| Intermediate | 90 | 32.20% | 16.70% | 0.00% | 51.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1206348060 | C -> DEL | N | N | silent_mutation | Average:55.168; most accessible tissue: Callus, score: 75.486 | N | N | N | N |
| vg1206348060 | C -> T | LOC_Os12g11690.1 | upstream_gene_variant ; 941.0bp to feature; MODIFIER | silent_mutation | Average:55.168; most accessible tissue: Callus, score: 75.486 | N | N | N | N |
| vg1206348060 | C -> T | LOC_Os12g11700.1 | upstream_gene_variant ; 680.0bp to feature; MODIFIER | silent_mutation | Average:55.168; most accessible tissue: Callus, score: 75.486 | N | N | N | N |
| vg1206348060 | C -> T | LOC_Os12g11680.1 | downstream_gene_variant ; 3971.0bp to feature; MODIFIER | silent_mutation | Average:55.168; most accessible tissue: Callus, score: 75.486 | N | N | N | N |
| vg1206348060 | C -> T | LOC_Os12g11690-LOC_Os12g11700 | intergenic_region ; MODIFIER | silent_mutation | Average:55.168; most accessible tissue: Callus, score: 75.486 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1206348060 | 5.93E-06 | 5.97E-06 | mr1381 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206348060 | 3.25E-06 | 3.23E-06 | mr1954 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |