Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206256269:

Variant ID: vg1206256269 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 6256269
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCATCGTGTGGGTAAAGCTGGGCAGACACTGCAGTCGTACCATAGTCGAATACAGCGTGCTCCCGGTTAAGGAGATATGTCATCAGGGTGATTCCTACTC[T/C]
TGAAGTATAAGTAGTTTTAAAATTAAAATGTTGAGGATAAATATGATTTATGGTTTTTATTACTCCATTACCTTATCATTGTTTTATTTATTTATATTCC

Reverse complement sequence

GGAATATAAATAAATAAAACAATGATAAGGTAATGGAGTAATAAAAACCATAAATCATATTTATCCTCAACATTTTAATTTTAAAACTACTTATACTTCA[A/G]
GAGTAGGAATCACCCTGATGACATATCTCCTTAACCGGGAGCACGCTGTATTCGACTATGGTACGACTGCAGTGTCTGCCCAGCTTTACCCACACGATGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.70%	6.80%	1.69%	15.79%	NA
All Indica	2759	91.90%	6.00%	0.54%	1.56%	NA
All Japonica	1512	51.90%	1.90%	3.77%	42.46%	NA
Aus	269	40.10%	42.00%	2.23%	15.61%	NA
Indica I	595	98.50%	0.80%	0.00%	0.67%	NA
Indica II	465	94.40%	4.30%	0.22%	1.08%	NA
Indica III	913	89.30%	8.50%	0.77%	1.42%	NA
Indica Intermediate	786	88.40%	8.00%	0.89%	2.67%	NA
Temperate Japonica	767	63.80%	0.90%	1.30%	34.03%	NA
Tropical Japonica	504	31.50%	3.40%	8.53%	56.55%	NA
Japonica Intermediate	241	56.80%	1.70%	1.66%	39.83%	NA
VI/Aromatic	96	87.50%	10.40%	0.00%	2.08%	NA
Intermediate	90	73.30%	5.60%	2.22%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1206256269	T -> C	LOC_Os12g11550.1	downstream_gene_variant ; 3345.0bp to feature; MODIFIER	silent_mutation	Average:46.003; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N
vg1206256269	T -> C	LOC_Os12g11530-LOC_Os12g11550	intergenic_region ; MODIFIER	silent_mutation	Average:46.003; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N
vg1206256269	T -> DEL	N	N	silent_mutation	Average:46.003; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1206256269	2.09E-06	2.09E-06	mr1067	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206256269	5.60E-07	8.57E-06	mr1613	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206256269	1.52E-07	4.39E-07	mr1962	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251