Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1206253234:

Variant ID: vg1206253234 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 6253234
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:

TTATCCAAAGTTAGAATTAAATCATTTGTATTTTCTTTTCTTCCCATTTGACTATTTTAATTTTTAAATATTAGAGAAAGTCTTACATTTGATTCTTATT[G/A]
AATTTTATAAAATTGGAGCATTTTTTTATCCTTATTGAATTCTTTTAAAATCTGAGCATCTTTATTCCCATTCTTTTCAAATTTATATTCTAAAAAATAA

Reverse complement sequence

TTATTTTTTAGAATATAAATTTGAAAAGAATGGGAATAAAGATGCTCAGATTTTAAAAGAATTCAATAAGGATAAAAAAATGCTCCAATTTTATAAAATT[C/T]
AATAAGAATCAAATGTAAGACTTTCTCTAATATTTAAAAATTAAAATAGTCAAATGGGAAGAAAAGAAAATACAAATGATTTAATTCTAACTTTGGATAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.10%	0.80%	8.63%	46.45%	NA
All Indica	2759	40.50%	1.40%	11.49%	46.61%	NA
All Japonica	1512	48.10%	0.00%	2.25%	49.67%	NA
Aus	269	39.00%	0.40%	17.84%	42.75%	NA
Indica I	595	94.50%	0.00%	1.18%	4.37%	NA
Indica II	465	21.10%	2.40%	10.11%	66.45%	NA
Indica III	913	12.90%	2.30%	21.80%	62.98%	NA
Indica Intermediate	786	43.30%	0.80%	8.14%	47.84%	NA
Temperate Japonica	767	58.70%	0.00%	3.65%	37.68%	NA
Tropical Japonica	504	28.00%	0.00%	0.99%	71.03%	NA
Japonica Intermediate	241	56.40%	0.00%	0.41%	43.15%	NA
VI/Aromatic	96	86.50%	0.00%	9.38%	4.17%	NA
Intermediate	90	55.60%	1.10%	0.00%	43.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1206253234	G -> DEL	N	N	silent_mutation	Average:20.99; most accessible tissue: Callus, score: 36.133	N	N	N	N
vg1206253234	G -> A	LOC_Os12g11530-LOC_Os12g11550	intergenic_region ; MODIFIER	silent_mutation	Average:20.99; most accessible tissue: Callus, score: 36.133	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1206253234	NA	7.63E-11	Grain_width	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1206253234	2.09E-06	2.59E-06	mr1143	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206253234	NA	1.88E-11	mr1565	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206253234	4.02E-06	NA	mr1698	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206253234	NA	9.91E-06	mr1508_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206253234	NA	9.70E-15	mr1565_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206253234	NA	1.40E-11	mr1565_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206253234	NA	7.02E-10	mr1861_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251