| Variant ID: vg1206253234 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 6253234 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 49. )
TTATCCAAAGTTAGAATTAAATCATTTGTATTTTCTTTTCTTCCCATTTGACTATTTTAATTTTTAAATATTAGAGAAAGTCTTACATTTGATTCTTATT[G/A]
AATTTTATAAAATTGGAGCATTTTTTTATCCTTATTGAATTCTTTTAAAATCTGAGCATCTTTATTCCCATTCTTTTCAAATTTATATTCTAAAAAATAA
TTATTTTTTAGAATATAAATTTGAAAAGAATGGGAATAAAGATGCTCAGATTTTAAAAGAATTCAATAAGGATAAAAAAATGCTCCAATTTTATAAAATT[C/T]
AATAAGAATCAAATGTAAGACTTTCTCTAATATTTAAAAATTAAAATAGTCAAATGGGAAGAAAAGAAAATACAAATGATTTAATTCTAACTTTGGATAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.10% | 0.80% | 8.63% | 46.45% | NA |
| All Indica | 2759 | 40.50% | 1.40% | 11.49% | 46.61% | NA |
| All Japonica | 1512 | 48.10% | 0.00% | 2.25% | 49.67% | NA |
| Aus | 269 | 39.00% | 0.40% | 17.84% | 42.75% | NA |
| Indica I | 595 | 94.50% | 0.00% | 1.18% | 4.37% | NA |
| Indica II | 465 | 21.10% | 2.40% | 10.11% | 66.45% | NA |
| Indica III | 913 | 12.90% | 2.30% | 21.80% | 62.98% | NA |
| Indica Intermediate | 786 | 43.30% | 0.80% | 8.14% | 47.84% | NA |
| Temperate Japonica | 767 | 58.70% | 0.00% | 3.65% | 37.68% | NA |
| Tropical Japonica | 504 | 28.00% | 0.00% | 0.99% | 71.03% | NA |
| Japonica Intermediate | 241 | 56.40% | 0.00% | 0.41% | 43.15% | NA |
| VI/Aromatic | 96 | 86.50% | 0.00% | 9.38% | 4.17% | NA |
| Intermediate | 90 | 55.60% | 1.10% | 0.00% | 43.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1206253234 | G -> DEL | N | N | silent_mutation | Average:20.99; most accessible tissue: Callus, score: 36.133 | N | N | N | N |
| vg1206253234 | G -> A | LOC_Os12g11530-LOC_Os12g11550 | intergenic_region ; MODIFIER | silent_mutation | Average:20.99; most accessible tissue: Callus, score: 36.133 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1206253234 | NA | 7.63E-11 | Grain_width | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1206253234 | 2.09E-06 | 2.59E-06 | mr1143 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206253234 | NA | 1.88E-11 | mr1565 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206253234 | 4.02E-06 | NA | mr1698 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206253234 | NA | 9.91E-06 | mr1508_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206253234 | NA | 9.70E-15 | mr1565_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206253234 | NA | 1.40E-11 | mr1565_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206253234 | NA | 7.02E-10 | mr1861_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |