\
| Variant ID: vg1206202617 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 6202617 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.13, others allele: 0.00, population size: 86. )
CAAAAATACAAAAAAAAAGAGGAAAATGAAAAAAGGAAAAAGAAACTGGATGTAGGGCTATTATCCACCTTGGAGGCCCGAACCAGTATAAAAGCCTTGT[G/A]
TCTTTCGCACTTGTGTGAATGATAATTCGTGGAAAAACCCCAAGGCAAACGCCTGATCAGCGAAAACGCCGGGGGGGGGCGAAACAAATCGGCCGAAGCA
TGCTTCGGCCGATTTGTTTCGCCCCCCCCCGGCGTTTTCGCTGATCAGGCGTTTGCCTTGGGGTTTTTCCACGAATTATCATTCACACAAGTGCGAAAGA[C/T]
ACAAGGCTTTTATACTGGTTCGGGCCTCCAAGGTGGATAATAGCCCTACATCCAGTTTCTTTTTCCTTTTTTCATTTTCCTCTTTTTTTTTGTATTTTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.00% | 32.10% | 2.39% | 26.56% | NA |
| All Indica | 2759 | 36.70% | 52.20% | 3.19% | 7.97% | NA |
| All Japonica | 1512 | 35.60% | 3.30% | 0.93% | 60.12% | NA |
| Aus | 269 | 60.20% | 1.90% | 2.97% | 34.94% | NA |
| Indica I | 595 | 77.50% | 7.70% | 3.87% | 10.92% | NA |
| Indica II | 465 | 12.90% | 76.80% | 1.51% | 8.82% | NA |
| Indica III | 913 | 19.40% | 74.50% | 2.08% | 4.05% | NA |
| Indica Intermediate | 786 | 39.90% | 45.30% | 4.96% | 9.80% | NA |
| Temperate Japonica | 767 | 48.20% | 3.40% | 1.17% | 47.20% | NA |
| Tropical Japonica | 504 | 12.30% | 4.20% | 0.60% | 82.94% | NA |
| Japonica Intermediate | 241 | 44.40% | 1.20% | 0.83% | 53.53% | NA |
| VI/Aromatic | 96 | 95.80% | 2.10% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 40.00% | 23.30% | 3.33% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1206202617 | G -> DEL | N | N | silent_mutation | Average:10.529; most accessible tissue: Callus, score: 35.156 | N | N | N | N |
| vg1206202617 | G -> A | LOC_Os12g11470.1 | downstream_gene_variant ; 4537.0bp to feature; MODIFIER | silent_mutation | Average:10.529; most accessible tissue: Callus, score: 35.156 | N | N | N | N |
| vg1206202617 | G -> A | LOC_Os12g11480.1 | downstream_gene_variant ; 312.0bp to feature; MODIFIER | silent_mutation | Average:10.529; most accessible tissue: Callus, score: 35.156 | N | N | N | N |
| vg1206202617 | G -> A | LOC_Os12g11490.1 | downstream_gene_variant ; 580.0bp to feature; MODIFIER | silent_mutation | Average:10.529; most accessible tissue: Callus, score: 35.156 | N | N | N | N |
| vg1206202617 | G -> A | LOC_Os12g11480-LOC_Os12g11490 | intergenic_region ; MODIFIER | silent_mutation | Average:10.529; most accessible tissue: Callus, score: 35.156 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1206202617 | NA | 2.31E-09 | mr1565 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206202617 | 8.03E-07 | NA | mr1845 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206202617 | 1.76E-06 | 1.76E-06 | mr1935 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206202617 | NA | 6.62E-06 | mr1508_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206202617 | NA | 2.21E-13 | mr1565_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206202617 | NA | 1.93E-10 | mr1565_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |