\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206197673:

Variant ID: vg1206197673 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 6197673
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


AGGCGCCGCGGCAGTACTCACTTCGCCAGGGGGTGTGCTGATTCGGTATGCCGCAAGGCTGTAGTTCGACACGACCAACAACATGGCAGAATACGAAGCT[G/A]
TACTATTAGGCCTAAGAAAGGCGAAAGCATTTGGGGTTCGGCGCTTGCTCATCCGAACGGACTCCAAGCTGGTGGCAAGTCATGTTGACAAGTCCTTCGA

Reverse complement sequence

TCGAAGGACTTGTCAACATGACTTGCCACCAGCTTGGAGTCCGTTCGGATGAGCAAGCGCCGAACCCCAAATGCTTTCGCCTTTCTTAGGCCTAATAGTA[C/T]
AGCTTCGTATTCTGCCATGTTGTTGGTCGTGTCGAACTACAGCCTTGCGGCATACCGAATCAGCACACCCCCTGGCGAAGTGAGTACTGCCGCGGCGCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.30% 32.00% 2.98% 21.71% NA
All Indica  2759 38.60% 52.00% 3.73% 5.62% NA
All Japonica  1512 45.20% 3.20% 1.79% 49.74% NA
Aus  269 60.20% 1.90% 1.86% 36.06% NA
Indica I  595 78.20% 7.20% 7.39% 7.23% NA
Indica II  465 14.40% 76.60% 1.29% 7.74% NA
Indica III  913 22.20% 74.50% 0.77% 2.52% NA
Indica Intermediate  786 42.00% 45.40% 5.85% 6.74% NA
Temperate Japonica  767 56.80% 3.40% 1.17% 38.59% NA
Tropical Japonica  504 25.60% 4.20% 2.98% 67.26% NA
Japonica Intermediate  241 49.40% 0.80% 1.24% 48.55% NA
VI/Aromatic  96 95.80% 2.10% 0.00% 2.08% NA
Intermediate  90 47.80% 23.30% 6.67% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1206197673 G -> DEL LOC_Os12g11470.1 N frameshift_variant Average:12.497; most accessible tissue: Callus, score: 25.092 N N N N
vg1206197673 G -> A LOC_Os12g11470.1 missense_variant ; p.Val7Ile; MODERATE nonsynonymous_codon ; V7I Average:12.497; most accessible tissue: Callus, score: 25.092 benign 0.329 TOLERATED 0.46

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1206197673 2.91E-07 NA mr1016 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206197673 7.27E-07 NA mr1055 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206197673 4.45E-06 NA mr1079 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206197673 1.01E-06 NA mr1132 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206197673 5.66E-07 NA mr1178 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206197673 1.87E-07 NA mr1390 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206197673 2.35E-07 NA mr1490 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206197673 5.93E-06 NA mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206197673 NA 4.87E-06 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206197673 NA 4.50E-06 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206197673 NA 1.16E-11 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206197673 NA 5.10E-10 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251