\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206197428:

Variant ID: vg1206197428 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 6197428
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTACTGTGCCATCGCAGTATCCTTTGGGCGAAGTGCTACGGGGCAAAGAAATCACTGGCCGACTCAGCAAGTGGGCGGCGGAATTATCCCCCTTCGACCT[A/G]
CATTTTGTCGCCCGCACCGCCATAAAGTCCCAAGTCCTAGCTGACTTCGTGGCCGAATGGACACTGGCATTCGCCCCTGAACCCGAGCCCGTCGAATAGC

Reverse complement sequence

GCTATTCGACGGGCTCGGGTTCAGGGGCGAATGCCAGTGTCCATTCGGCCACGAAGTCAGCTAGGACTTGGGACTTTATGGCGGTGCGGGCGACAAAATG[T/C]
AGGTCGAAGGGGGATAATTCCGCCGCCCACTTGCTGAGTCGGCCAGTGATTTCTTTGCCCCGTAGCACTTCGCCCAAAGGATACTGCGATGGCACAGTAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.70% 10.70% 5.18% 10.45% NA
All Indica  2759 91.10% 1.40% 2.50% 5.00% NA
All Japonica  1512 40.00% 29.60% 10.32% 20.11% NA
Aus  269 76.60% 0.70% 7.06% 15.61% NA
Indica I  595 95.50% 1.20% 0.17% 3.19% NA
Indica II  465 85.80% 2.40% 2.37% 9.46% NA
Indica III  913 89.30% 0.90% 5.48% 4.38% NA
Indica Intermediate  786 93.00% 1.70% 0.89% 4.45% NA
Temperate Japonica  767 53.70% 11.10% 9.26% 25.95% NA
Tropical Japonica  504 19.40% 57.50% 12.70% 10.32% NA
Japonica Intermediate  241 39.40% 29.90% 8.71% 21.99% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 71.10% 17.80% 1.11% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1206197428 A -> DEL N N silent_mutation Average:14.577; most accessible tissue: Callus, score: 40.488 N N N N
vg1206197428 A -> G LOC_Os12g11450.1 upstream_gene_variant ; 3846.0bp to feature; MODIFIER silent_mutation Average:14.577; most accessible tissue: Callus, score: 40.488 N N N N
vg1206197428 A -> G LOC_Os12g11470.1 upstream_gene_variant ; 227.0bp to feature; MODIFIER silent_mutation Average:14.577; most accessible tissue: Callus, score: 40.488 N N N N
vg1206197428 A -> G LOC_Os12g11480.1 upstream_gene_variant ; 3952.0bp to feature; MODIFIER silent_mutation Average:14.577; most accessible tissue: Callus, score: 40.488 N N N N
vg1206197428 A -> G LOC_Os12g11460.1 downstream_gene_variant ; 1941.0bp to feature; MODIFIER silent_mutation Average:14.577; most accessible tissue: Callus, score: 40.488 N N N N
vg1206197428 A -> G LOC_Os12g11460-LOC_Os12g11470 intergenic_region ; MODIFIER silent_mutation Average:14.577; most accessible tissue: Callus, score: 40.488 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1206197428 2.31E-06 NA mr1042_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206197428 NA 4.99E-07 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206197428 NA 1.31E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206197428 NA 2.41E-07 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206197428 6.63E-06 7.77E-12 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206197428 2.72E-06 1.83E-14 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206197428 6.05E-06 NA mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251