\
| Variant ID: vg1206197428 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 6197428 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTACTGTGCCATCGCAGTATCCTTTGGGCGAAGTGCTACGGGGCAAAGAAATCACTGGCCGACTCAGCAAGTGGGCGGCGGAATTATCCCCCTTCGACCT[A/G]
CATTTTGTCGCCCGCACCGCCATAAAGTCCCAAGTCCTAGCTGACTTCGTGGCCGAATGGACACTGGCATTCGCCCCTGAACCCGAGCCCGTCGAATAGC
GCTATTCGACGGGCTCGGGTTCAGGGGCGAATGCCAGTGTCCATTCGGCCACGAAGTCAGCTAGGACTTGGGACTTTATGGCGGTGCGGGCGACAAAATG[T/C]
AGGTCGAAGGGGGATAATTCCGCCGCCCACTTGCTGAGTCGGCCAGTGATTTCTTTGCCCCGTAGCACTTCGCCCAAAGGATACTGCGATGGCACAGTAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.70% | 10.70% | 5.18% | 10.45% | NA |
| All Indica | 2759 | 91.10% | 1.40% | 2.50% | 5.00% | NA |
| All Japonica | 1512 | 40.00% | 29.60% | 10.32% | 20.11% | NA |
| Aus | 269 | 76.60% | 0.70% | 7.06% | 15.61% | NA |
| Indica I | 595 | 95.50% | 1.20% | 0.17% | 3.19% | NA |
| Indica II | 465 | 85.80% | 2.40% | 2.37% | 9.46% | NA |
| Indica III | 913 | 89.30% | 0.90% | 5.48% | 4.38% | NA |
| Indica Intermediate | 786 | 93.00% | 1.70% | 0.89% | 4.45% | NA |
| Temperate Japonica | 767 | 53.70% | 11.10% | 9.26% | 25.95% | NA |
| Tropical Japonica | 504 | 19.40% | 57.50% | 12.70% | 10.32% | NA |
| Japonica Intermediate | 241 | 39.40% | 29.90% | 8.71% | 21.99% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 71.10% | 17.80% | 1.11% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1206197428 | A -> DEL | N | N | silent_mutation | Average:14.577; most accessible tissue: Callus, score: 40.488 | N | N | N | N |
| vg1206197428 | A -> G | LOC_Os12g11450.1 | upstream_gene_variant ; 3846.0bp to feature; MODIFIER | silent_mutation | Average:14.577; most accessible tissue: Callus, score: 40.488 | N | N | N | N |
| vg1206197428 | A -> G | LOC_Os12g11470.1 | upstream_gene_variant ; 227.0bp to feature; MODIFIER | silent_mutation | Average:14.577; most accessible tissue: Callus, score: 40.488 | N | N | N | N |
| vg1206197428 | A -> G | LOC_Os12g11480.1 | upstream_gene_variant ; 3952.0bp to feature; MODIFIER | silent_mutation | Average:14.577; most accessible tissue: Callus, score: 40.488 | N | N | N | N |
| vg1206197428 | A -> G | LOC_Os12g11460.1 | downstream_gene_variant ; 1941.0bp to feature; MODIFIER | silent_mutation | Average:14.577; most accessible tissue: Callus, score: 40.488 | N | N | N | N |
| vg1206197428 | A -> G | LOC_Os12g11460-LOC_Os12g11470 | intergenic_region ; MODIFIER | silent_mutation | Average:14.577; most accessible tissue: Callus, score: 40.488 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1206197428 | 2.31E-06 | NA | mr1042_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206197428 | NA | 4.99E-07 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206197428 | NA | 1.31E-07 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206197428 | NA | 2.41E-07 | mr1502_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206197428 | 6.63E-06 | 7.77E-12 | mr1680_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206197428 | 2.72E-06 | 1.83E-14 | mr1742_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206197428 | 6.05E-06 | NA | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |