Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206197428:

Variant ID: vg1206197428 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 6197428
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTACTGTGCCATCGCAGTATCCTTTGGGCGAAGTGCTACGGGGCAAAGAAATCACTGGCCGACTCAGCAAGTGGGCGGCGGAATTATCCCCCTTCGACCT[A/G]
CATTTTGTCGCCCGCACCGCCATAAAGTCCCAAGTCCTAGCTGACTTCGTGGCCGAATGGACACTGGCATTCGCCCCTGAACCCGAGCCCGTCGAATAGC

Reverse complement sequence

GCTATTCGACGGGCTCGGGTTCAGGGGCGAATGCCAGTGTCCATTCGGCCACGAAGTCAGCTAGGACTTGGGACTTTATGGCGGTGCGGGCGACAAAATG[T/C]
AGGTCGAAGGGGGATAATTCCGCCGCCCACTTGCTGAGTCGGCCAGTGATTTCTTTGCCCCGTAGCACTTCGCCCAAAGGATACTGCGATGGCACAGTAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.70%	10.70%	5.18%	10.45%	NA
All Indica	2759	91.10%	1.40%	2.50%	5.00%	NA
All Japonica	1512	40.00%	29.60%	10.32%	20.11%	NA
Aus	269	76.60%	0.70%	7.06%	15.61%	NA
Indica I	595	95.50%	1.20%	0.17%	3.19%	NA
Indica II	465	85.80%	2.40%	2.37%	9.46%	NA
Indica III	913	89.30%	0.90%	5.48%	4.38%	NA
Indica Intermediate	786	93.00%	1.70%	0.89%	4.45%	NA
Temperate Japonica	767	53.70%	11.10%	9.26%	25.95%	NA
Tropical Japonica	504	19.40%	57.50%	12.70%	10.32%	NA
Japonica Intermediate	241	39.40%	29.90%	8.71%	21.99%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	71.10%	17.80%	1.11%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1206197428	A -> DEL	N	N	silent_mutation	Average:14.577; most accessible tissue: Callus, score: 40.488	N	N	N	N
vg1206197428	A -> G	LOC_Os12g11450.1	upstream_gene_variant ; 3846.0bp to feature; MODIFIER	silent_mutation	Average:14.577; most accessible tissue: Callus, score: 40.488	N	N	N	N
vg1206197428	A -> G	LOC_Os12g11470.1	upstream_gene_variant ; 227.0bp to feature; MODIFIER	silent_mutation	Average:14.577; most accessible tissue: Callus, score: 40.488	N	N	N	N
vg1206197428	A -> G	LOC_Os12g11480.1	upstream_gene_variant ; 3952.0bp to feature; MODIFIER	silent_mutation	Average:14.577; most accessible tissue: Callus, score: 40.488	N	N	N	N
vg1206197428	A -> G	LOC_Os12g11460.1	downstream_gene_variant ; 1941.0bp to feature; MODIFIER	silent_mutation	Average:14.577; most accessible tissue: Callus, score: 40.488	N	N	N	N
vg1206197428	A -> G	LOC_Os12g11460-LOC_Os12g11470	intergenic_region ; MODIFIER	silent_mutation	Average:14.577; most accessible tissue: Callus, score: 40.488	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1206197428	2.31E-06	NA	mr1042_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206197428	NA	4.99E-07	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206197428	NA	1.31E-07	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206197428	NA	2.41E-07	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206197428	6.63E-06	7.77E-12	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206197428	2.72E-06	1.83E-14	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206197428	6.05E-06	NA	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251