\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206195784:

Variant ID: vg1206195784 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 6195784
Reference Allele: GAlternative Allele: A,GAAA,GAAATTCAT,GAAATTCA
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, A: 0.28, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


CGCTTCGTGGTTTTGGCGGTAGAGAAGTTCAAGTTTTGGGCCAAGTACAACTGGTGGTAGCTTTCGGCACAAGTGAAAACAGGCGCGTAGAGCAAATACT[G/A,GAAA,GAAATTCAT,GAAATTCA]
TTCGATGTCGTCGACATCCCATACAACTACAATGCCATCTTCGGCCGCGCAATCTTGAACAAGTTCGAAGCCATCTCCCACCACAACTACCTCAAGCTCA

Reverse complement sequence

TGAGCTTGAGGTAGTTGTGGTGGGAGATGGCTTCGAACTTGTTCAAGATTGCGCGGCCGAAGATGGCATTGTAGTTGTATGGGATGTCGACGACATCGAA[C/T,TTTC,ATGAATTTC,TGAATTTC]
AGTATTTGCTCTACGCGCCTGTTTTCACTTGTGCCGAAAGCTACCACCAGTTGTACTTGGCCCAAAACTTGAACTTCTCTACCGCCAAAACCACGAAGCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.70% 35.10% 8.57% 9.16% GAAA: 0.19%; GAAATTCAT: 0.11%; GAAATTCA: 0.08%
All Indica  2759 66.20% 16.10% 13.48% 3.59% GAAA: 0.33%; GAAATTCAT: 0.18%; GAAATTCA: 0.11%
All Japonica  1512 9.40% 71.00% 1.06% 18.45% GAAATTCA: 0.07%
Aus  269 42.80% 36.80% 3.35% 17.10% NA
Indica I  595 21.30% 31.40% 41.85% 3.36% GAAA: 1.34%; GAAATTCA: 0.34%; GAAATTCAT: 0.34%
Indica II  465 77.20% 9.00% 3.44% 10.32% NA
Indica III  913 91.90% 6.50% 0.88% 0.66% GAAA: 0.11%
Indica Intermediate  786 63.90% 19.80% 12.60% 3.18% GAAATTCAT: 0.38%; GAAATTCA: 0.13%
Temperate Japonica  767 14.50% 58.50% 1.30% 25.55% GAAATTCA: 0.13%
Tropical Japonica  504 4.60% 85.90% 0.79% 8.73% NA
Japonica Intermediate  241 3.30% 79.70% 0.83% 16.18% NA
VI/Aromatic  96 89.60% 4.20% 6.25% 0.00% NA
Intermediate  90 43.30% 44.40% 2.22% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1206195784 G -> A LOC_Os12g11450.1 upstream_gene_variant ; 2202.0bp to feature; MODIFIER silent_mutation Average:13.16; most accessible tissue: Callus, score: 32.711 N N N N
vg1206195784 G -> A LOC_Os12g11470.1 upstream_gene_variant ; 1871.0bp to feature; MODIFIER silent_mutation Average:13.16; most accessible tissue: Callus, score: 32.711 N N N N
vg1206195784 G -> A LOC_Os12g11460.1 downstream_gene_variant ; 297.0bp to feature; MODIFIER silent_mutation Average:13.16; most accessible tissue: Callus, score: 32.711 N N N N
vg1206195784 G -> A LOC_Os12g11460-LOC_Os12g11470 intergenic_region ; MODIFIER silent_mutation Average:13.16; most accessible tissue: Callus, score: 32.711 N N N N
vg1206195784 G -> GAAATTCA LOC_Os12g11450.1 upstream_gene_variant ; 2203.0bp to feature; MODIFIER silent_mutation Average:13.16; most accessible tissue: Callus, score: 32.711 N N N N
vg1206195784 G -> GAAATTCA LOC_Os12g11470.1 upstream_gene_variant ; 1870.0bp to feature; MODIFIER silent_mutation Average:13.16; most accessible tissue: Callus, score: 32.711 N N N N
vg1206195784 G -> GAAATTCA LOC_Os12g11460.1 downstream_gene_variant ; 298.0bp to feature; MODIFIER silent_mutation Average:13.16; most accessible tissue: Callus, score: 32.711 N N N N
vg1206195784 G -> GAAATTCA LOC_Os12g11460-LOC_Os12g11470 intergenic_region ; MODIFIER silent_mutation Average:13.16; most accessible tissue: Callus, score: 32.711 N N N N
vg1206195784 G -> GAAATTCAT LOC_Os12g11450.1 upstream_gene_variant ; 2203.0bp to feature; MODIFIER silent_mutation Average:13.16; most accessible tissue: Callus, score: 32.711 N N N N
vg1206195784 G -> GAAATTCAT LOC_Os12g11470.1 upstream_gene_variant ; 1870.0bp to feature; MODIFIER silent_mutation Average:13.16; most accessible tissue: Callus, score: 32.711 N N N N
vg1206195784 G -> GAAATTCAT LOC_Os12g11460.1 downstream_gene_variant ; 298.0bp to feature; MODIFIER silent_mutation Average:13.16; most accessible tissue: Callus, score: 32.711 N N N N
vg1206195784 G -> GAAATTCAT LOC_Os12g11460-LOC_Os12g11470 intergenic_region ; MODIFIER silent_mutation Average:13.16; most accessible tissue: Callus, score: 32.711 N N N N
vg1206195784 G -> GAAA LOC_Os12g11450.1 upstream_gene_variant ; 2203.0bp to feature; MODIFIER silent_mutation Average:13.16; most accessible tissue: Callus, score: 32.711 N N N N
vg1206195784 G -> GAAA LOC_Os12g11470.1 upstream_gene_variant ; 1870.0bp to feature; MODIFIER silent_mutation Average:13.16; most accessible tissue: Callus, score: 32.711 N N N N
vg1206195784 G -> GAAA LOC_Os12g11460.1 downstream_gene_variant ; 298.0bp to feature; MODIFIER silent_mutation Average:13.16; most accessible tissue: Callus, score: 32.711 N N N N
vg1206195784 G -> GAAA LOC_Os12g11460-LOC_Os12g11470 intergenic_region ; MODIFIER silent_mutation Average:13.16; most accessible tissue: Callus, score: 32.711 N N N N
vg1206195784 G -> DEL N N silent_mutation Average:13.16; most accessible tissue: Callus, score: 32.711 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1206195784 5.08E-06 5.08E-06 mr1024 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206195784 NA 4.23E-07 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206195784 7.07E-07 1.48E-06 mr1940 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206195784 NA 8.14E-15 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206195784 1.88E-06 9.22E-06 mr1565_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251