\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206186379:

Variant ID: vg1206186379 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 6186379
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TACTCAAATATAAATAGGAAGAGAATTATACCAGTAGGAATGCCTTCTTTTCCATTTGCTTTCTTTGTCTTAAGGGACGCCAATGCCAAAACCGTTTCAC[C/T]
GTATATTCTTCAAATGATTGATGCGGTTACTTGTAGCTTCAAATGGTCTCGCACGGTCCATCATGACAAAGCCATCACTCGCCCTTCACCACCGGATTTG

Reverse complement sequence

CAAATCCGGTGGTGAAGGGCGAGTGATGGCTTTGTCATGATGGACCGTGCGAGACCATTTGAAGCTACAAGTAACCGCATCAATCATTTGAAGAATATAC[G/A]
GTGAAACGGTTTTGGCATTGGCGTCCCTTAAGACAAAGAAAGCAAATGGAAAAGAAGGCATTCCTACTGGTATAATTCTCTTCCTATTTATATTTGAGTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.60% 1.40% 5.18% 16.76% NA
All Indica  2759 92.00% 0.40% 2.54% 5.04% NA
All Japonica  1512 46.60% 2.70% 9.92% 40.74% NA
Aus  269 79.90% 5.20% 7.81% 7.06% NA
Indica I  595 88.10% 0.00% 2.69% 9.24% NA
Indica II  465 92.30% 0.00% 2.80% 4.95% NA
Indica III  913 97.00% 0.10% 1.10% 1.75% NA
Indica Intermediate  786 89.10% 1.30% 3.94% 5.73% NA
Temperate Japonica  767 59.60% 0.00% 2.22% 38.20% NA
Tropical Japonica  504 22.00% 6.00% 23.41% 48.61% NA
Japonica Intermediate  241 56.80% 4.60% 6.22% 32.37% NA
VI/Aromatic  96 97.90% 1.00% 0.00% 1.04% NA
Intermediate  90 75.60% 1.10% 4.44% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1206186379 C -> DEL N N silent_mutation Average:6.692; most accessible tissue: Callus, score: 13.889 N N N N
vg1206186379 C -> T LOC_Os12g11440.1 downstream_gene_variant ; 661.0bp to feature; MODIFIER silent_mutation Average:6.692; most accessible tissue: Callus, score: 13.889 N N N N
vg1206186379 C -> T LOC_Os12g11440-LOC_Os12g11450 intergenic_region ; MODIFIER silent_mutation Average:6.692; most accessible tissue: Callus, score: 13.889 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1206186379 NA 2.55E-06 mr1339 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379 NA 2.47E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379 NA 2.25E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379 NA 3.28E-07 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379 5.82E-06 1.19E-07 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379 NA 1.04E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379 NA 4.95E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379 NA 4.44E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379 NA 5.47E-06 mr1462_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379 1.30E-06 5.26E-08 mr1470_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379 NA 7.40E-06 mr1483_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379 NA 4.19E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379 NA 1.30E-09 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379 NA 8.27E-06 mr1544_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379 NA 2.92E-06 mr1638_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379 NA 4.33E-06 mr1665_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379 NA 8.03E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379 1.66E-06 1.17E-13 mr1680_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379 NA 4.86E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379 NA 5.79E-07 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379 NA 1.87E-06 mr1736_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379 3.27E-07 3.26E-07 mr1777_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379 NA 1.04E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379 NA 4.15E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251