Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206186379:

Variant ID: vg1206186379 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 6186379
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

TACTCAAATATAAATAGGAAGAGAATTATACCAGTAGGAATGCCTTCTTTTCCATTTGCTTTCTTTGTCTTAAGGGACGCCAATGCCAAAACCGTTTCAC[C/T]
GTATATTCTTCAAATGATTGATGCGGTTACTTGTAGCTTCAAATGGTCTCGCACGGTCCATCATGACAAAGCCATCACTCGCCCTTCACCACCGGATTTG

Reverse complement sequence

CAAATCCGGTGGTGAAGGGCGAGTGATGGCTTTGTCATGATGGACCGTGCGAGACCATTTGAAGCTACAAGTAACCGCATCAATCATTTGAAGAATATAC[G/A]
GTGAAACGGTTTTGGCATTGGCGTCCCTTAAGACAAAGAAAGCAAATGGAAAAGAAGGCATTCCTACTGGTATAATTCTCTTCCTATTTATATTTGAGTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.60%	1.40%	5.18%	16.76%	NA
All Indica	2759	92.00%	0.40%	2.54%	5.04%	NA
All Japonica	1512	46.60%	2.70%	9.92%	40.74%	NA
Aus	269	79.90%	5.20%	7.81%	7.06%	NA
Indica I	595	88.10%	0.00%	2.69%	9.24%	NA
Indica II	465	92.30%	0.00%	2.80%	4.95%	NA
Indica III	913	97.00%	0.10%	1.10%	1.75%	NA
Indica Intermediate	786	89.10%	1.30%	3.94%	5.73%	NA
Temperate Japonica	767	59.60%	0.00%	2.22%	38.20%	NA
Tropical Japonica	504	22.00%	6.00%	23.41%	48.61%	NA
Japonica Intermediate	241	56.80%	4.60%	6.22%	32.37%	NA
VI/Aromatic	96	97.90%	1.00%	0.00%	1.04%	NA
Intermediate	90	75.60%	1.10%	4.44%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1206186379	C -> DEL	N	N	silent_mutation	Average:6.692; most accessible tissue: Callus, score: 13.889	N	N	N	N
vg1206186379	C -> T	LOC_Os12g11440.1	downstream_gene_variant ; 661.0bp to feature; MODIFIER	silent_mutation	Average:6.692; most accessible tissue: Callus, score: 13.889	N	N	N	N
vg1206186379	C -> T	LOC_Os12g11440-LOC_Os12g11450	intergenic_region ; MODIFIER	silent_mutation	Average:6.692; most accessible tissue: Callus, score: 13.889	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1206186379	NA	2.55E-06	mr1339	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379	NA	2.47E-06	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379	NA	2.25E-06	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379	NA	3.28E-07	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379	5.82E-06	1.19E-07	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379	NA	1.04E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379	NA	4.95E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379	NA	4.44E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379	NA	5.47E-06	mr1462_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379	1.30E-06	5.26E-08	mr1470_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379	NA	7.40E-06	mr1483_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379	NA	4.19E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379	NA	1.30E-09	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379	NA	8.27E-06	mr1544_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379	NA	2.92E-06	mr1638_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379	NA	4.33E-06	mr1665_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379	NA	8.03E-06	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379	1.66E-06	1.17E-13	mr1680_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379	NA	4.86E-07	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379	NA	5.79E-07	mr1687_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379	NA	1.87E-06	mr1736_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379	3.27E-07	3.26E-07	mr1777_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379	NA	1.04E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206186379	NA	4.15E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251