Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1205988878:

Variant ID: vg1205988878 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 5988878
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, A: 0.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

ACCTGTGATATTTCAAGGATCGGATAATCAGGTTGCCCATCTCGGATTTATTTGCGTTGGAGCAAGGCAAGTTATTATTCCTCTCCTTTGAGCATAAATA[C/A]
CCTATATTCTATATCTCTGTTCTATGCATTAGTCATACATGATTTCAAATGCATAACCTGAACATAGCAAACCAGATATGCTAGATTTTGCTTAGCCATG

Reverse complement sequence

CATGGCTAAGCAAAATCTAGCATATCTGGTTTGCTATGTTCAGGTTATGCATTTGAAATCATGTATGACTAATGCATAGAACAGAGATATAGAATATAGG[G/T]
TATTTATGCTCAAAGGAGAGGAATAATAACTTGCCTTGCTCCAACGCAAATAAATCCGAGATGGGCAACCTGATTATCCGATCCTTGAAATATCACAGGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.30%	14.40%	6.01%	10.33%	NA
All Indica	2759	76.50%	21.70%	1.78%	0.07%	NA
All Japonica	1512	51.70%	1.90%	14.42%	31.94%	NA
Aus	269	78.40%	17.10%	4.09%	0.37%	NA
Indica I	595	77.00%	20.30%	2.69%	0.00%	NA
Indica II	465	96.10%	3.20%	0.65%	0.00%	NA
Indica III	913	61.00%	37.10%	1.86%	0.00%	NA
Indica Intermediate	786	82.40%	15.60%	1.65%	0.25%	NA
Temperate Japonica	767	52.20%	0.70%	14.21%	32.99%	NA
Tropical Japonica	504	44.80%	4.60%	18.65%	31.94%	NA
Japonica Intermediate	241	64.70%	0.40%	6.22%	28.63%	NA
VI/Aromatic	96	96.90%	0.00%	2.08%	1.04%	NA
Intermediate	90	86.70%	7.80%	4.44%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1205988878	C -> DEL	N	N	silent_mutation	Average:44.744; most accessible tissue: Minghui63 flag leaf, score: 69.681	N	N	N	N
vg1205988878	C -> A	LOC_Os12g11110.1	downstream_gene_variant ; 3963.0bp to feature; MODIFIER	silent_mutation	Average:44.744; most accessible tissue: Minghui63 flag leaf, score: 69.681	N	N	N	N
vg1205988878	C -> A	LOC_Os12g11110-LOC_Os12g11130	intergenic_region ; MODIFIER	silent_mutation	Average:44.744; most accessible tissue: Minghui63 flag leaf, score: 69.681	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1205988878	NA	3.72E-07	mr1519	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205988878	NA	2.98E-06	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205988878	NA	5.23E-07	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205988878	2.60E-08	NA	mr1519_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205988878	7.57E-08	4.06E-14	mr1519_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205988878	NA	5.81E-06	mr1901_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251