\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1205988878:

Variant ID: vg1205988878 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 5988878
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, A: 0.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


ACCTGTGATATTTCAAGGATCGGATAATCAGGTTGCCCATCTCGGATTTATTTGCGTTGGAGCAAGGCAAGTTATTATTCCTCTCCTTTGAGCATAAATA[C/A]
CCTATATTCTATATCTCTGTTCTATGCATTAGTCATACATGATTTCAAATGCATAACCTGAACATAGCAAACCAGATATGCTAGATTTTGCTTAGCCATG

Reverse complement sequence

CATGGCTAAGCAAAATCTAGCATATCTGGTTTGCTATGTTCAGGTTATGCATTTGAAATCATGTATGACTAATGCATAGAACAGAGATATAGAATATAGG[G/T]
TATTTATGCTCAAAGGAGAGGAATAATAACTTGCCTTGCTCCAACGCAAATAAATCCGAGATGGGCAACCTGATTATCCGATCCTTGAAATATCACAGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.30% 14.40% 6.01% 10.33% NA
All Indica  2759 76.50% 21.70% 1.78% 0.07% NA
All Japonica  1512 51.70% 1.90% 14.42% 31.94% NA
Aus  269 78.40% 17.10% 4.09% 0.37% NA
Indica I  595 77.00% 20.30% 2.69% 0.00% NA
Indica II  465 96.10% 3.20% 0.65% 0.00% NA
Indica III  913 61.00% 37.10% 1.86% 0.00% NA
Indica Intermediate  786 82.40% 15.60% 1.65% 0.25% NA
Temperate Japonica  767 52.20% 0.70% 14.21% 32.99% NA
Tropical Japonica  504 44.80% 4.60% 18.65% 31.94% NA
Japonica Intermediate  241 64.70% 0.40% 6.22% 28.63% NA
VI/Aromatic  96 96.90% 0.00% 2.08% 1.04% NA
Intermediate  90 86.70% 7.80% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1205988878 C -> DEL N N silent_mutation Average:44.744; most accessible tissue: Minghui63 flag leaf, score: 69.681 N N N N
vg1205988878 C -> A LOC_Os12g11110.1 downstream_gene_variant ; 3963.0bp to feature; MODIFIER silent_mutation Average:44.744; most accessible tissue: Minghui63 flag leaf, score: 69.681 N N N N
vg1205988878 C -> A LOC_Os12g11110-LOC_Os12g11130 intergenic_region ; MODIFIER silent_mutation Average:44.744; most accessible tissue: Minghui63 flag leaf, score: 69.681 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1205988878 NA 3.72E-07 mr1519 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205988878 NA 2.98E-06 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205988878 NA 5.23E-07 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205988878 2.60E-08 NA mr1519_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205988878 7.57E-08 4.06E-14 mr1519_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205988878 NA 5.81E-06 mr1901_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251