\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1205859092:

Variant ID: vg1205859092 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 5859092
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.80, C: 0.20, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


GGCGCCGTCGCAGTGGACGCCCTCCCAGCGACAGCAGTCTGCACCAGGGACCCATGATCGAAAGGTGGTGGAGTAGTCGCCGGCCGTCGCGTTGAAGGAG[T/C]
GCTTCAGCCGGAGCAGCGCGGAAGCCTGGTCTGGAAGGCACATTGCCGGCGTCGTTTCGGAGGAGGTCGTCGTAAGGTCGTCGAGCGTGGTGGCCTGGAC

Reverse complement sequence

GTCCAGGCCACCACGCTCGACGACCTTACGACGACCTCCTCCGAAACGACGCCGGCAATGTGCCTTCCAGACCAGGCTTCCGCGCTGCTCCGGCTGAAGC[A/G]
CTCCTTCAACGCGACGGCCGGCGACTACTCCACCACCTTTCGATCATGGGTCCCTGGTGCAGACTGCTGTCGCTGGGAGGGCGTCCACTGCGACGGCGCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.60% 32.60% 4.25% 28.50% NA
All Indica  2759 39.30% 51.80% 3.44% 5.47% NA
All Japonica  1512 21.40% 5.00% 2.31% 71.23% NA
Aus  269 49.10% 2.60% 19.33% 29.00% NA
Indica I  595 92.30% 4.20% 1.01% 2.52% NA
Indica II  465 19.10% 74.20% 2.15% 4.52% NA
Indica III  913 11.10% 77.00% 5.37% 6.57% NA
Indica Intermediate  786 43.90% 45.30% 3.82% 7.00% NA
Temperate Japonica  767 27.00% 6.90% 2.87% 63.23% NA
Tropical Japonica  504 6.30% 3.80% 2.38% 87.50% NA
Japonica Intermediate  241 35.30% 1.70% 0.41% 62.66% NA
VI/Aromatic  96 60.40% 10.40% 15.62% 13.54% NA
Intermediate  90 41.10% 23.30% 4.44% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1205859092 T -> C LOC_Os12g10870.1 missense_variant ; p.His58Arg; MODERATE nonsynonymous_codon ; H58R Average:85.591; most accessible tissue: Minghui63 flag leaf, score: 92.416 unknown unknown TOLERATED 1.00
vg1205859092 T -> DEL LOC_Os12g10870.1 N frameshift_variant Average:85.591; most accessible tissue: Minghui63 flag leaf, score: 92.416 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1205859092 T C -0.01 -0.01 0.0 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1205859092 NA 9.21E-11 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1205859092 NA 9.01E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205859092 NA 6.62E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205859092 NA 2.42E-10 mr1565 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205859092 NA 2.36E-06 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205859092 4.64E-06 4.64E-06 mr1473_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205859092 NA 2.62E-06 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205859092 NA 3.45E-14 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205859092 NA 3.60E-12 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205859092 NA 3.15E-09 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251