\
| Variant ID: vg1205811494 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 5811494 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAGTGGACATGTGGAAGGAACAAAATATCAGAGCGTCAAGGCAATGGTACCTTAGTACTAACAGCAAAAGTAATACTGGTCTACACAGCAAAAGTAAGCC[A/T]
AAAGAAAAGTGCACACAACCACTCAATAGGTGGACCACTACTGCCGAGGACTCTTACCCCGGTCCCTCCTGCCCTGCGCCCTAACGTGTCCCTGGGAATA
TATTCCCAGGGACACGTTAGGGCGCAGGGCAGGAGGGACCGGGGTAAGAGTCCTCGGCAGTAGTGGTCCACCTATTGAGTGGTTGTGTGCACTTTTCTTT[T/A]
GGCTTACTTTTGCTGTGTAGACCAGTATTACTTTTGCTGTTAGTACTAAGGTACCATTGCCTTGACGCTCTGATATTTTGTTCCTTCCACATGTCCACTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.70% | 0.90% | 3.05% | 23.40% | NA |
| All Indica | 2759 | 66.00% | 1.40% | 3.04% | 29.54% | NA |
| All Japonica | 1512 | 94.20% | 0.10% | 1.59% | 4.10% | NA |
| Aus | 269 | 36.10% | 0.00% | 8.55% | 55.39% | NA |
| Indica I | 595 | 16.00% | 2.40% | 6.05% | 75.63% | NA |
| Indica II | 465 | 93.30% | 0.00% | 0.43% | 6.24% | NA |
| Indica III | 913 | 85.70% | 1.60% | 1.97% | 10.73% | NA |
| Indica Intermediate | 786 | 65.00% | 1.10% | 3.56% | 30.28% | NA |
| Temperate Japonica | 767 | 91.10% | 0.00% | 2.87% | 6.00% | NA |
| Tropical Japonica | 504 | 97.40% | 0.00% | 0.20% | 2.38% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.40% | 0.41% | 1.66% | NA |
| VI/Aromatic | 96 | 18.80% | 2.10% | 12.50% | 66.67% | NA |
| Intermediate | 90 | 81.10% | 0.00% | 1.11% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1205811494 | A -> DEL | N | N | silent_mutation | Average:23.152; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg1205811494 | A -> T | LOC_Os12g10784.1 | downstream_gene_variant ; 4256.0bp to feature; MODIFIER | silent_mutation | Average:23.152; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg1205811494 | A -> T | LOC_Os12g10784.2 | downstream_gene_variant ; 4256.0bp to feature; MODIFIER | silent_mutation | Average:23.152; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg1205811494 | A -> T | LOC_Os12g10784.3 | downstream_gene_variant ; 4256.0bp to feature; MODIFIER | silent_mutation | Average:23.152; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg1205811494 | A -> T | LOC_Os12g10800.1 | intron_variant ; MODIFIER | silent_mutation | Average:23.152; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1205811494 | 2.56E-06 | NA | mr1439 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205811494 | 4.24E-06 | 4.24E-06 | mr1442 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205811494 | 4.67E-06 | NA | mr1705 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205811494 | 7.22E-07 | 3.93E-06 | mr1803 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205811494 | 7.89E-06 | NA | mr1965 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |