Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1205810983:

Variant ID: vg1205810983 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 5810983
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCGAAAGGATCGCTTCGCCAGTTGAGACGCTCAAGAAATGGAGCTTCCATTCTCTCTAGATGTGTGGGAAGATGAAAGATGATATGAAGAGCTTGTATTC[G/A]
GCTTGTCTATTATATAGGGCCGCAACTAGTGCTATAACTAGACTTAATTTTGTTCATCTGGCGCACTTGATGTGACAACACGCGCACGCGTGAGCATCAT

Reverse complement sequence

ATGATGCTCACGCGTGCGCGTGTTGTCACATCAAGTGCGCCAGATGAACAAAATTAAGTCTAGTTATAGCACTAGTTGCGGCCCTATATAATAGACAAGC[C/T]
GAATACAAGCTCTTCATATCATCTTTCATCTTCCCACACATCTAGAGAGAATGGAAGCTCCATTTCTTGAGCGTCTCAACTGGCGAAGCGATCCTTTCGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.20%	3.60%	8.76%	2.43%	NA
All Indica	2759	80.40%	6.10%	12.36%	1.20%	NA
All Japonica	1512	95.10%	0.00%	3.24%	1.65%	NA
Aus	269	94.80%	0.70%	2.97%	1.49%	NA
Indica I	595	39.70%	22.70%	35.63%	2.02%	NA
Indica II	465	97.40%	0.00%	1.08%	1.51%	NA
Indica III	913	96.50%	0.40%	2.19%	0.88%	NA
Indica Intermediate	786	82.30%	3.70%	13.23%	0.76%	NA
Temperate Japonica	767	91.40%	0.00%	5.87%	2.74%	NA
Tropical Japonica	504	98.80%	0.00%	0.60%	0.60%	NA
Japonica Intermediate	241	99.20%	0.00%	0.41%	0.41%	NA
VI/Aromatic	96	35.40%	0.00%	14.58%	50.00%	NA
Intermediate	90	91.10%	1.10%	2.22%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1205810983	G -> DEL	N	N	silent_mutation	Average:10.431; most accessible tissue: Callus, score: 29.984	N	N	N	N
vg1205810983	G -> A	LOC_Os12g10784.1	downstream_gene_variant ; 3745.0bp to feature; MODIFIER	silent_mutation	Average:10.431; most accessible tissue: Callus, score: 29.984	N	N	N	N
vg1205810983	G -> A	LOC_Os12g10784.2	downstream_gene_variant ; 3745.0bp to feature; MODIFIER	silent_mutation	Average:10.431; most accessible tissue: Callus, score: 29.984	N	N	N	N
vg1205810983	G -> A	LOC_Os12g10784.3	downstream_gene_variant ; 3745.0bp to feature; MODIFIER	silent_mutation	Average:10.431; most accessible tissue: Callus, score: 29.984	N	N	N	N
vg1205810983	G -> A	LOC_Os12g10800.1	intron_variant ; MODIFIER	silent_mutation	Average:10.431; most accessible tissue: Callus, score: 29.984	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1205810983	NA	7.60E-06	mr1318	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205810983	NA	9.18E-07	mr1378	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205810983	NA	2.29E-06	mr1637	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205810983	3.03E-06	3.03E-06	mr1652	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205810983	NA	9.25E-06	mr1669	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251