\
| Variant ID: vg1205810983 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 5810983 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCGAAAGGATCGCTTCGCCAGTTGAGACGCTCAAGAAATGGAGCTTCCATTCTCTCTAGATGTGTGGGAAGATGAAAGATGATATGAAGAGCTTGTATTC[G/A]
GCTTGTCTATTATATAGGGCCGCAACTAGTGCTATAACTAGACTTAATTTTGTTCATCTGGCGCACTTGATGTGACAACACGCGCACGCGTGAGCATCAT
ATGATGCTCACGCGTGCGCGTGTTGTCACATCAAGTGCGCCAGATGAACAAAATTAAGTCTAGTTATAGCACTAGTTGCGGCCCTATATAATAGACAAGC[C/T]
GAATACAAGCTCTTCATATCATCTTTCATCTTCCCACACATCTAGAGAGAATGGAAGCTCCATTTCTTGAGCGTCTCAACTGGCGAAGCGATCCTTTCGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.20% | 3.60% | 8.76% | 2.43% | NA |
| All Indica | 2759 | 80.40% | 6.10% | 12.36% | 1.20% | NA |
| All Japonica | 1512 | 95.10% | 0.00% | 3.24% | 1.65% | NA |
| Aus | 269 | 94.80% | 0.70% | 2.97% | 1.49% | NA |
| Indica I | 595 | 39.70% | 22.70% | 35.63% | 2.02% | NA |
| Indica II | 465 | 97.40% | 0.00% | 1.08% | 1.51% | NA |
| Indica III | 913 | 96.50% | 0.40% | 2.19% | 0.88% | NA |
| Indica Intermediate | 786 | 82.30% | 3.70% | 13.23% | 0.76% | NA |
| Temperate Japonica | 767 | 91.40% | 0.00% | 5.87% | 2.74% | NA |
| Tropical Japonica | 504 | 98.80% | 0.00% | 0.60% | 0.60% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 35.40% | 0.00% | 14.58% | 50.00% | NA |
| Intermediate | 90 | 91.10% | 1.10% | 2.22% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1205810983 | G -> DEL | N | N | silent_mutation | Average:10.431; most accessible tissue: Callus, score: 29.984 | N | N | N | N |
| vg1205810983 | G -> A | LOC_Os12g10784.1 | downstream_gene_variant ; 3745.0bp to feature; MODIFIER | silent_mutation | Average:10.431; most accessible tissue: Callus, score: 29.984 | N | N | N | N |
| vg1205810983 | G -> A | LOC_Os12g10784.2 | downstream_gene_variant ; 3745.0bp to feature; MODIFIER | silent_mutation | Average:10.431; most accessible tissue: Callus, score: 29.984 | N | N | N | N |
| vg1205810983 | G -> A | LOC_Os12g10784.3 | downstream_gene_variant ; 3745.0bp to feature; MODIFIER | silent_mutation | Average:10.431; most accessible tissue: Callus, score: 29.984 | N | N | N | N |
| vg1205810983 | G -> A | LOC_Os12g10800.1 | intron_variant ; MODIFIER | silent_mutation | Average:10.431; most accessible tissue: Callus, score: 29.984 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1205810983 | NA | 7.60E-06 | mr1318 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205810983 | NA | 9.18E-07 | mr1378 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205810983 | NA | 2.29E-06 | mr1637 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205810983 | 3.03E-06 | 3.03E-06 | mr1652 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205810983 | NA | 9.25E-06 | mr1669 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |