\
| Variant ID: vg1205810555 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 5810555 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 254. )
GTCACCACAACGACACTCTGGATGTTCCCGCCATGTGGGGAGTCCTAGGGGGTTTACCTGCCATTCTAAAGCTTCTGCAGCAATCCGACGTTCATGCTCA[T/C]
CCTTCCGCCTGAGGTAGTCCGATCTTGATTCACTACGTGCATATGGACGTGTTCCGTCGTTTTGTGGGTTCTCTGTATCTACCCACTCAATGTAGTTGCA
TGCAACTACATTGAGTGGGTAGATACAGAGAACCCACAAAACGACGGAACACGTCCATATGCACGTAGTGAATCAAGATCGGACTACCTCAGGCGGAAGG[A/G]
TGAGCATGAACGTCGGATTGCTGCAGAAGCTTTAGAATGGCAGGTAAACCCCCTAGGACTCCCCACATGGCGGGAACATCCAGAGTGTCGTTGTGGTGAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.70% | 0.90% | 1.29% | 4.08% | NA |
| All Indica | 2759 | 94.20% | 1.50% | 1.16% | 3.15% | NA |
| All Japonica | 1512 | 95.20% | 0.00% | 1.79% | 2.98% | NA |
| Aus | 269 | 98.50% | 0.00% | 0.37% | 1.12% | NA |
| Indica I | 595 | 86.20% | 2.40% | 2.18% | 9.24% | NA |
| Indica II | 465 | 97.60% | 0.00% | 1.08% | 1.29% | NA |
| Indica III | 913 | 97.50% | 2.00% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 94.30% | 1.30% | 1.15% | 3.31% | NA |
| Temperate Japonica | 767 | 91.90% | 0.00% | 2.74% | 5.35% | NA |
| Tropical Japonica | 504 | 98.40% | 0.00% | 1.19% | 0.40% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 45.80% | 1.00% | 0.00% | 53.12% | NA |
| Intermediate | 90 | 91.10% | 0.00% | 1.11% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1205810555 | T -> C | LOC_Os12g10800.1 | missense_variant ; p.Asp1388Gly; MODERATE | nonsynonymous_codon ; D1388G | Average:21.674; most accessible tissue: Callus, score: 29.978 | unknown | unknown | DELETERIOUS | 0.02 |
| vg1205810555 | T -> DEL | LOC_Os12g10800.1 | N | frameshift_variant | Average:21.674; most accessible tissue: Callus, score: 29.978 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1205810555 | 1.93E-06 | NA | mr1035 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205810555 | NA | 5.10E-06 | mr1277 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205810555 | 3.55E-06 | 4.71E-06 | mr1346 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205810555 | 2.14E-06 | 2.14E-06 | mr1442 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205810555 | 3.80E-06 | 3.75E-06 | mr1456 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205810555 | 7.47E-06 | NA | mr1626 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205810555 | 1.66E-06 | NA | mr1705 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205810555 | 3.61E-07 | 8.98E-07 | mr1803 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205810555 | 2.47E-06 | NA | mr1965 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205810555 | NA | 8.19E-06 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |