Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1205810295:

Variant ID: vg1205810295 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 5810295
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGCGTGGTCGTCTCAGGTTGCGTTATCGTTTGACCAATGGAAGTAACTCTGACCGTATCGATCCATTGTATGAATTGACATTTCCTAACCTCCTCCTAT[T/A]
TGAAAATTTGTGTAAATAGAGGTAAGTGCATGAAAGTAGTGATTAGTGGTACCCAAAAAAAAAGATACTTACGACGAAATCATCGTCGTCAATGTTAGGA

Reverse complement sequence

TCCTAACATTGACGACGATGATTTCGTCGTAAGTATCTTTTTTTTTGGGTACCACTAATCACTACTTTCATGCACTTACCTCTATTTACACAAATTTTCA[A/T]
ATAGGAGGAGGTTAGGAAATGTCAATTCATACAATGGATCGATACGGTCAGAGTTACTTCCATTGGTCAAACGATAACGCAACCTGAGACGACCACGCAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.40%	29.00%	7.83%	10.77%	NA
All Indica	2759	74.60%	3.10%	10.33%	12.00%	NA
All Japonica	1512	17.10%	76.90%	1.19%	4.76%	NA
Aus	269	40.50%	29.00%	20.07%	10.41%	NA
Indica I	595	36.50%	2.00%	24.54%	36.97%	NA
Indica II	465	92.90%	3.00%	1.51%	2.58%	NA
Indica III	913	92.70%	2.10%	4.82%	0.44%	NA
Indica Intermediate	786	71.60%	5.10%	11.20%	12.09%	NA
Temperate Japonica	767	21.60%	68.80%	0.78%	8.74%	NA
Tropical Japonica	504	3.80%	93.80%	1.98%	0.40%	NA
Japonica Intermediate	241	30.70%	67.20%	0.83%	1.24%	NA
VI/Aromatic	96	18.80%	3.10%	8.33%	69.79%	NA
Intermediate	90	34.40%	47.80%	5.56%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1205810295	T -> DEL	N	N	silent_mutation	Average:20.777; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1205810295	T -> A	LOC_Os12g10784.1	downstream_gene_variant ; 3057.0bp to feature; MODIFIER	silent_mutation	Average:20.777; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1205810295	T -> A	LOC_Os12g10784.2	downstream_gene_variant ; 3057.0bp to feature; MODIFIER	silent_mutation	Average:20.777; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1205810295	T -> A	LOC_Os12g10784.3	downstream_gene_variant ; 3057.0bp to feature; MODIFIER	silent_mutation	Average:20.777; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1205810295	T -> A	LOC_Os12g10800.1	intron_variant ; MODIFIER	silent_mutation	Average:20.777; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1205810295	NA	3.75E-07	mr1071	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205810295	2.97E-06	3.21E-07	mr1080	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205810295	4.17E-06	3.49E-07	mr1203	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205810295	NA	9.96E-08	mr1334	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205810295	NA	9.25E-06	mr1395	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205810295	4.92E-07	4.65E-07	mr1618	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205810295	NA	6.53E-06	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205810295	NA	1.63E-07	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205810295	NA	1.84E-06	mr1610_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205810295	NA	1.35E-09	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205810295	NA	4.46E-06	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205810295	NA	1.68E-08	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205810295	NA	8.37E-07	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251