\
| Variant ID: vg1205788235 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr12 | Position: 5788235 |
| Reference Allele: TTA | Alternative Allele: CTA,T |
| Primary Allele: TTA | Secondary Allele: CTA |
Inferred Ancestral Allele: Not determined.
ATTCCTTTTTTTTGGAACTTTGTAACTCTTATTCCTTCAATTGTTCCACTGTTCTCTTGTGGCATTTTTTTCTAAAATACCGATAATAAATGTCTCAAGA[TTA/CTA,T]
TGTTTTATCTGACAGTTTATTAAATGCCTCTAATAAATGCCATTAGACTCCACTCAAGTTGTTTTCAGAGGCATAGTACAAAATGCATGCCTCTACTATA
TATAGTAGAGGCATGCATTTTGTACTATGCCTCTGAAAACAACTTGAGTGGAGTCTAATGGCATTTATTAGAGGCATTTAATAAACTGTCAGATAAAACA[TAA/TAG,A]
TCTTGAGACATTTATTATCGGTATTTTAGAAAAAAATGCCACAAGAGAACAGTGGAACAATTGAAGGAATAAGAGTTACAAAGTTCCAAAAAAAAGGAAT
| Populations | Population Size | Frequency of TTA(primary allele) | Frequency of CTA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.30% | 8.40% | 1.23% | 0.00% | T: 0.08% |
| All Indica | 2759 | 99.20% | 0.60% | 0.14% | 0.00% | T: 0.07% |
| All Japonica | 1512 | 72.80% | 23.80% | 3.37% | 0.00% | NA |
| Aus | 269 | 98.50% | 0.70% | 0.74% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.10% | 0.00% | 0.00% | T: 0.22% |
| Indica III | 913 | 99.20% | 0.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 98.90% | 0.80% | 0.25% | 0.00% | T: 0.13% |
| Temperate Japonica | 767 | 55.70% | 38.70% | 5.61% | 0.00% | NA |
| Tropical Japonica | 504 | 95.20% | 4.00% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.50% | 17.80% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 14.40% | 1.11% | 0.00% | T: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1205788235 | TTA -> CTA | LOC_Os12g10760.1 | upstream_gene_variant ; 1666.0bp to feature; MODIFIER | silent_mutation | Average:50.796; most accessible tissue: Callus, score: 82.325 | N | N | N | N |
| vg1205788235 | TTA -> CTA | LOC_Os12g10770.1 | upstream_gene_variant ; 4786.0bp to feature; MODIFIER | silent_mutation | Average:50.796; most accessible tissue: Callus, score: 82.325 | N | N | N | N |
| vg1205788235 | TTA -> CTA | LOC_Os12g10760-LOC_Os12g10770 | intergenic_region ; MODIFIER | silent_mutation | Average:50.796; most accessible tissue: Callus, score: 82.325 | N | N | N | N |
| vg1205788235 | TTA -> T | LOC_Os12g10760.1 | upstream_gene_variant ; 1667.0bp to feature; MODIFIER | silent_mutation | Average:50.796; most accessible tissue: Callus, score: 82.325 | N | N | N | N |
| vg1205788235 | TTA -> T | LOC_Os12g10770.1 | upstream_gene_variant ; 4785.0bp to feature; MODIFIER | silent_mutation | Average:50.796; most accessible tissue: Callus, score: 82.325 | N | N | N | N |
| vg1205788235 | TTA -> T | LOC_Os12g10760-LOC_Os12g10770 | intergenic_region ; MODIFIER | silent_mutation | Average:50.796; most accessible tissue: Callus, score: 82.325 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1205788235 | 7.26E-06 | 7.26E-06 | mr1260 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205788235 | NA | 8.13E-06 | mr1708 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205788235 | 4.33E-06 | 4.31E-06 | mr1736 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205788235 | NA | 8.88E-07 | mr1803 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205788235 | NA | 3.29E-06 | mr1577_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205788235 | NA | 3.95E-06 | mr1966_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |