Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1205699592:

Variant ID: vg1205699592 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 5699592
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

TGACTTTTTAAAATATGTTTGACCGTTTGTCTTATTCAAAAATTTTAAGTAATTATTAATTCTTTTTCTATCATTTGATTCATTGTTAAATATAATTTTA[T/C]
GTATACATATAGTTTTACATATTTCATAAAAGTTTTTGAATAAGACGAACAGTTAAACATGTGCTAAAAAGTTAACGGTGTCAAATATTTAGAAACGGAG

Reverse complement sequence

CTCCGTTTCTAAATATTTGACACCGTTAACTTTTTAGCACATGTTTAACTGTTCGTCTTATTCAAAAACTTTTATGAAATATGTAAAACTATATGTATAC[A/G]
TAAAATTATATTTAACAATGAATCAAATGATAGAAAAAGAATTAATAATTACTTAAAATTTTTGAATAAGACAAACGGTCAAACATATTTTAAAAAGTCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.40%	38.50%	0.08%	0.00%	NA
All Indica	2759	35.30%	64.60%	0.11%	0.00%	NA
All Japonica	1512	99.10%	0.90%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	74.50%	25.50%	0.00%	0.00%	NA
Indica II	465	22.20%	77.60%	0.22%	0.00%	NA
Indica III	913	11.30%	88.70%	0.00%	0.00%	NA
Indica Intermediate	786	41.50%	58.30%	0.25%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	98.00%	2.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	78.90%	20.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1205699592	T -> C	LOC_Os12g10660.1	upstream_gene_variant ; 198.0bp to feature; MODIFIER	silent_mutation	Average:64.526; most accessible tissue: Zhenshan97 young leaf, score: 73.923	N	N	N	N
vg1205699592	T -> C	LOC_Os12g10650.1	downstream_gene_variant ; 3314.0bp to feature; MODIFIER	silent_mutation	Average:64.526; most accessible tissue: Zhenshan97 young leaf, score: 73.923	N	N	N	N
vg1205699592	T -> C	LOC_Os12g10670.1	downstream_gene_variant ; 3460.0bp to feature; MODIFIER	silent_mutation	Average:64.526; most accessible tissue: Zhenshan97 young leaf, score: 73.923	N	N	N	N
vg1205699592	T -> C	LOC_Os12g10650-LOC_Os12g10660	intergenic_region ; MODIFIER	silent_mutation	Average:64.526; most accessible tissue: Zhenshan97 young leaf, score: 73.923	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1205699592	NA	6.20E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592	NA	7.02E-13	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592	NA	6.76E-07	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592	NA	1.49E-07	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592	NA	8.62E-06	mr1285	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592	NA	6.00E-06	mr1304	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592	3.68E-06	3.94E-08	mr1375	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592	NA	6.69E-06	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592	NA	3.21E-06	mr1511	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592	NA	4.45E-06	mr1656	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592	5.14E-06	5.14E-06	mr1673	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592	NA	1.28E-07	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592	NA	4.40E-07	mr1757	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592	NA	5.04E-10	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592	NA	6.50E-07	mr1864	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592	NA	4.44E-07	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592	NA	4.93E-07	mr1968	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592	NA	2.53E-06	mr1970	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592	NA	1.23E-07	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251