\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1205699592:

Variant ID: vg1205699592 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 5699592
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


TGACTTTTTAAAATATGTTTGACCGTTTGTCTTATTCAAAAATTTTAAGTAATTATTAATTCTTTTTCTATCATTTGATTCATTGTTAAATATAATTTTA[T/C]
GTATACATATAGTTTTACATATTTCATAAAAGTTTTTGAATAAGACGAACAGTTAAACATGTGCTAAAAAGTTAACGGTGTCAAATATTTAGAAACGGAG

Reverse complement sequence

CTCCGTTTCTAAATATTTGACACCGTTAACTTTTTAGCACATGTTTAACTGTTCGTCTTATTCAAAAACTTTTATGAAATATGTAAAACTATATGTATAC[A/G]
TAAAATTATATTTAACAATGAATCAAATGATAGAAAAAGAATTAATAATTACTTAAAATTTTTGAATAAGACAAACGGTCAAACATATTTTAAAAAGTCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.40% 38.50% 0.08% 0.00% NA
All Indica  2759 35.30% 64.60% 0.11% 0.00% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 74.50% 25.50% 0.00% 0.00% NA
Indica II  465 22.20% 77.60% 0.22% 0.00% NA
Indica III  913 11.30% 88.70% 0.00% 0.00% NA
Indica Intermediate  786 41.50% 58.30% 0.25% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 78.90% 20.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1205699592 T -> C LOC_Os12g10660.1 upstream_gene_variant ; 198.0bp to feature; MODIFIER silent_mutation Average:64.526; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N
vg1205699592 T -> C LOC_Os12g10650.1 downstream_gene_variant ; 3314.0bp to feature; MODIFIER silent_mutation Average:64.526; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N
vg1205699592 T -> C LOC_Os12g10670.1 downstream_gene_variant ; 3460.0bp to feature; MODIFIER silent_mutation Average:64.526; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N
vg1205699592 T -> C LOC_Os12g10650-LOC_Os12g10660 intergenic_region ; MODIFIER silent_mutation Average:64.526; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1205699592 NA 6.20E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592 NA 7.02E-13 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592 NA 6.76E-07 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592 NA 1.49E-07 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592 NA 8.62E-06 mr1285 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592 NA 6.00E-06 mr1304 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592 3.68E-06 3.94E-08 mr1375 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592 NA 6.69E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592 NA 3.21E-06 mr1511 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592 NA 4.45E-06 mr1656 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592 5.14E-06 5.14E-06 mr1673 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592 NA 1.28E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592 NA 4.40E-07 mr1757 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592 NA 5.04E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592 NA 6.50E-07 mr1864 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592 NA 4.44E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592 NA 4.93E-07 mr1968 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592 NA 2.53E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205699592 NA 1.23E-07 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251