Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1205690365:

Variant ID: vg1205690365 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 5690365
Reference Allele: A	Alternative Allele: C,G
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.01, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

GTTCTGTAATTTGTTTTGTTATTAGATTACGTTTAATACTTTAAATGTGTGTCCGTATATCCGATGTGATACGCCAAAACTTTTCACCCCTGAAACTAAC[A/C,G]
GACTATGTTTTGTTTATGTGCACACATTTATCTCTATAAATACACATCCTACTTCGCTAAACATCTCGAGAAAAACATAATAGTAACAATTTTCTTTACA

Reverse complement sequence

TGTAAAGAAAATTGTTACTATTATGTTTTTCTCGAGATGTTTAGCGAAGTAGGATGTGTATTTATAGAGATAAATGTGTGCACATAAACAAAACATAGTC[T/G,C]
GTTAGTTTCAGGGGTGAAAAGTTTTGGCGTATCACATCGGATATACGGACACACATTTAAAGTATTAAACGTAATCTAATAACAAAACAAATTACAGAAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.40%	1.50%	0.00%	0.00%	G: 0.08%
All Indica	2759	99.80%	0.10%	0.00%	0.00%	G: 0.14%
All Japonica	1512	95.50%	4.50%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.60%	0.00%	0.00%	0.00%	G: 0.44%
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	91.30%	8.70%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1205690365	A -> C	LOC_Os12g10640.1	upstream_gene_variant ; 464.0bp to feature; MODIFIER	silent_mutation	Average:52.018; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg1205690365	A -> C	LOC_Os12g10650.1	upstream_gene_variant ; 2496.0bp to feature; MODIFIER	silent_mutation	Average:52.018; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg1205690365	A -> C	LOC_Os12g10640-LOC_Os12g10650	intergenic_region ; MODIFIER	silent_mutation	Average:52.018; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg1205690365	A -> G	LOC_Os12g10640.1	upstream_gene_variant ; 464.0bp to feature; MODIFIER	silent_mutation	Average:52.018; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg1205690365	A -> G	LOC_Os12g10650.1	upstream_gene_variant ; 2496.0bp to feature; MODIFIER	silent_mutation	Average:52.018; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg1205690365	A -> G	LOC_Os12g10640-LOC_Os12g10650	intergenic_region ; MODIFIER	silent_mutation	Average:52.018; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1205690365	NA	3.89E-06	mr1028	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205690365	NA	6.60E-06	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205690365	4.58E-07	4.58E-07	mr1369	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205690365	NA	1.84E-06	mr1453	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205690365	NA	1.74E-06	mr1510	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205690365	NA	2.29E-06	mr1648	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205690365	NA	4.04E-07	mr1652	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251