\
| Variant ID: vg1205690365 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 5690365 |
| Reference Allele: A | Alternative Allele: C,G |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.01, others allele: 0.00, population size: 200. )
GTTCTGTAATTTGTTTTGTTATTAGATTACGTTTAATACTTTAAATGTGTGTCCGTATATCCGATGTGATACGCCAAAACTTTTCACCCCTGAAACTAAC[A/C,G]
GACTATGTTTTGTTTATGTGCACACATTTATCTCTATAAATACACATCCTACTTCGCTAAACATCTCGAGAAAAACATAATAGTAACAATTTTCTTTACA
TGTAAAGAAAATTGTTACTATTATGTTTTTCTCGAGATGTTTAGCGAAGTAGGATGTGTATTTATAGAGATAAATGTGTGCACATAAACAAAACATAGTC[T/G,C]
GTTAGTTTCAGGGGTGAAAAGTTTTGGCGTATCACATCGGATATACGGACACACATTTAAAGTATTAAACGTAATCTAATAACAAAACAAATTACAGAAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.40% | 1.50% | 0.00% | 0.00% | G: 0.08% |
| All Indica | 2759 | 99.80% | 0.10% | 0.00% | 0.00% | G: 0.14% |
| All Japonica | 1512 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.00% | 0.00% | 0.00% | G: 0.44% |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 91.30% | 8.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1205690365 | A -> C | LOC_Os12g10640.1 | upstream_gene_variant ; 464.0bp to feature; MODIFIER | silent_mutation | Average:52.018; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1205690365 | A -> C | LOC_Os12g10650.1 | upstream_gene_variant ; 2496.0bp to feature; MODIFIER | silent_mutation | Average:52.018; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1205690365 | A -> C | LOC_Os12g10640-LOC_Os12g10650 | intergenic_region ; MODIFIER | silent_mutation | Average:52.018; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1205690365 | A -> G | LOC_Os12g10640.1 | upstream_gene_variant ; 464.0bp to feature; MODIFIER | silent_mutation | Average:52.018; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1205690365 | A -> G | LOC_Os12g10650.1 | upstream_gene_variant ; 2496.0bp to feature; MODIFIER | silent_mutation | Average:52.018; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1205690365 | A -> G | LOC_Os12g10640-LOC_Os12g10650 | intergenic_region ; MODIFIER | silent_mutation | Average:52.018; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1205690365 | NA | 3.89E-06 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205690365 | NA | 6.60E-06 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205690365 | 4.58E-07 | 4.58E-07 | mr1369 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205690365 | NA | 1.84E-06 | mr1453 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205690365 | NA | 1.74E-06 | mr1510 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205690365 | NA | 2.29E-06 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205690365 | NA | 4.04E-07 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |