\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1205690365:

Variant ID: vg1205690365 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 5690365
Reference Allele: AAlternative Allele: C,G
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.01, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


GTTCTGTAATTTGTTTTGTTATTAGATTACGTTTAATACTTTAAATGTGTGTCCGTATATCCGATGTGATACGCCAAAACTTTTCACCCCTGAAACTAAC[A/C,G]
GACTATGTTTTGTTTATGTGCACACATTTATCTCTATAAATACACATCCTACTTCGCTAAACATCTCGAGAAAAACATAATAGTAACAATTTTCTTTACA

Reverse complement sequence

TGTAAAGAAAATTGTTACTATTATGTTTTTCTCGAGATGTTTAGCGAAGTAGGATGTGTATTTATAGAGATAAATGTGTGCACATAAACAAAACATAGTC[T/G,C]
GTTAGTTTCAGGGGTGAAAAGTTTTGGCGTATCACATCGGATATACGGACACACATTTAAAGTATTAAACGTAATCTAATAACAAAACAAATTACAGAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.40% 1.50% 0.00% 0.00% G: 0.08%
All Indica  2759 99.80% 0.10% 0.00% 0.00% G: 0.14%
All Japonica  1512 95.50% 4.50% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.60% 0.00% 0.00% 0.00% G: 0.44%
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 91.30% 8.70% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1205690365 A -> C LOC_Os12g10640.1 upstream_gene_variant ; 464.0bp to feature; MODIFIER silent_mutation Average:52.018; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg1205690365 A -> C LOC_Os12g10650.1 upstream_gene_variant ; 2496.0bp to feature; MODIFIER silent_mutation Average:52.018; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg1205690365 A -> C LOC_Os12g10640-LOC_Os12g10650 intergenic_region ; MODIFIER silent_mutation Average:52.018; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg1205690365 A -> G LOC_Os12g10640.1 upstream_gene_variant ; 464.0bp to feature; MODIFIER silent_mutation Average:52.018; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg1205690365 A -> G LOC_Os12g10650.1 upstream_gene_variant ; 2496.0bp to feature; MODIFIER silent_mutation Average:52.018; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg1205690365 A -> G LOC_Os12g10640-LOC_Os12g10650 intergenic_region ; MODIFIER silent_mutation Average:52.018; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1205690365 NA 3.89E-06 mr1028 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205690365 NA 6.60E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205690365 4.58E-07 4.58E-07 mr1369 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205690365 NA 1.84E-06 mr1453 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205690365 NA 1.74E-06 mr1510 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205690365 NA 2.29E-06 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205690365 NA 4.04E-07 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251