Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1205663824:

Variant ID: vg1205663824 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 5663824
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.19, others allele: 0.00, population size: 31. )

Flanking Sequence (100 bp) in Reference Genome:

CGTAATTCGTCGAGTTATCATATATCGTACATAATCTCTGGCAATATTACTATCTAACCTACAATCGGCTAACATCTGTTAGTAGAGGGCAGCCGATTAG[A/G]
TTAGATTTTGATGTTGATTTAGATTATATAAGATATCCACCACTCTATGAAACTTTCAGCGGCTTGATTGTCTAGATATTGTTCTTCTTTTCATACTTAA

Reverse complement sequence

TTAAGTATGAAAAGAAGAACAATATCTAGACAATCAAGCCGCTGAAAGTTTCATAGAGTGGTGGATATCTTATATAATCTAAATCAACATCAAAATCTAA[T/C]
CTAATCGGCTGCCCTCTACTAACAGATGTTAGCCGATTGTAGGTTAGATAGTAATATTGCCAGAGATTATGTACGATATATGATAACTCGACGAATTACG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.40%	39.40%	9.06%	0.11%	NA
All Indica	2759	82.40%	5.20%	12.21%	0.18%	NA
All Japonica	1512	1.60%	96.60%	1.85%	0.00%	NA
Aus	269	39.00%	39.80%	21.19%	0.00%	NA
Indica I	595	78.00%	3.20%	18.49%	0.34%	NA
Indica II	465	82.60%	4.50%	12.69%	0.22%	NA
Indica III	913	87.00%	4.40%	8.65%	0.00%	NA
Indica Intermediate	786	80.30%	8.10%	11.32%	0.25%	NA
Temperate Japonica	767	1.60%	95.30%	3.13%	0.00%	NA
Tropical Japonica	504	2.20%	97.40%	0.40%	0.00%	NA
Japonica Intermediate	241	0.40%	98.80%	0.83%	0.00%	NA
VI/Aromatic	96	2.10%	96.90%	1.04%	0.00%	NA
Intermediate	90	28.90%	65.60%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1205663824	A -> DEL	N	N	silent_mutation	Average:15.355; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg1205663824	A -> G	LOC_Os12g10610.1	upstream_gene_variant ; 4375.0bp to feature; MODIFIER	silent_mutation	Average:15.355; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg1205663824	A -> G	LOC_Os12g10620.1	upstream_gene_variant ; 974.0bp to feature; MODIFIER	silent_mutation	Average:15.355; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg1205663824	A -> G	LOC_Os12g10620-LOC_Os12g10630	intergenic_region ; MODIFIER	silent_mutation	Average:15.355; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1205663824	NA	7.56E-06	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205663824	NA	2.14E-09	mr1379	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205663824	NA	1.05E-08	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205663824	NA	2.49E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205663824	NA	6.85E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205663824	NA	3.63E-10	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205663824	NA	1.02E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205663824	NA	2.01E-15	mr1578_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205663824	NA	2.87E-15	mr1744_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205663824	NA	1.98E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205663824	6.53E-07	6.42E-07	mr1958_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251