\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1205555293:

Variant ID: vg1205555293 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 5555293
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, T: 0.15, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:


GTGATGCGTGACAATGGCACTGTTATGAATTGCTTGCCAACAATGATTCCCAACAATTTGATATGCTGCAAACAGTGACAACCTCGTTTGATCAACTGCA[G/T]
AGTCCACCCATGTTCATGATTATGTCCATTTATTGGCATGCCAATTTCATCAGTCAAGCATATGCATTGCCCAGTAGATCCTAATGTATTTACCACCTAT

Reverse complement sequence

ATAGGTGGTAAATACATTAGGATCTACTGGGCAATGCATATGCTTGACTGATGAAATTGGCATGCCAATAAATGGACATAATCATGAACATGGGTGGACT[C/A]
TGCAGTTGATCAAACGAGGTTGTCACTGTTTGCAGCATATCAAATTGTTGGGAATCATTGTTGGCAAGCAATTCATAACAGTGCCATTGTCACGCATCAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.40% 44.60% 0.70% 0.36% NA
All Indica  2759 90.10% 8.90% 0.76% 0.22% NA
All Japonica  1512 1.10% 98.90% 0.00% 0.07% NA
Aus  269 13.80% 78.10% 4.46% 3.72% NA
Indica I  595 96.00% 3.40% 0.67% 0.00% NA
Indica II  465 91.20% 8.40% 0.43% 0.00% NA
Indica III  913 91.90% 7.30% 0.66% 0.11% NA
Indica Intermediate  786 83.10% 15.10% 1.15% 0.64% NA
Temperate Japonica  767 0.70% 99.30% 0.00% 0.00% NA
Tropical Japonica  504 2.00% 97.80% 0.00% 0.20% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 31.10% 68.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1205555293 G -> DEL N N silent_mutation Average:12.499; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg1205555293 G -> T LOC_Os12g10490.1 upstream_gene_variant ; 2844.0bp to feature; MODIFIER silent_mutation Average:12.499; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg1205555293 G -> T LOC_Os12g10470.1 downstream_gene_variant ; 496.0bp to feature; MODIFIER silent_mutation Average:12.499; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg1205555293 G -> T LOC_Os12g10480.1 downstream_gene_variant ; 610.0bp to feature; MODIFIER silent_mutation Average:12.499; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg1205555293 G -> T LOC_Os12g10470-LOC_Os12g10480 intergenic_region ; MODIFIER silent_mutation Average:12.499; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1205555293 NA 6.59E-16 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205555293 NA 3.81E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205555293 NA 5.03E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205555293 NA 1.33E-15 mr1914 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205555293 NA 2.45E-07 mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205555293 NA 1.23E-07 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251