Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1205555293:

Variant ID: vg1205555293 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 5555293
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, T: 0.15, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:

GTGATGCGTGACAATGGCACTGTTATGAATTGCTTGCCAACAATGATTCCCAACAATTTGATATGCTGCAAACAGTGACAACCTCGTTTGATCAACTGCA[G/T]
AGTCCACCCATGTTCATGATTATGTCCATTTATTGGCATGCCAATTTCATCAGTCAAGCATATGCATTGCCCAGTAGATCCTAATGTATTTACCACCTAT

Reverse complement sequence

ATAGGTGGTAAATACATTAGGATCTACTGGGCAATGCATATGCTTGACTGATGAAATTGGCATGCCAATAAATGGACATAATCATGAACATGGGTGGACT[C/A]
TGCAGTTGATCAAACGAGGTTGTCACTGTTTGCAGCATATCAAATTGTTGGGAATCATTGTTGGCAAGCAATTCATAACAGTGCCATTGTCACGCATCAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.40%	44.60%	0.70%	0.36%	NA
All Indica	2759	90.10%	8.90%	0.76%	0.22%	NA
All Japonica	1512	1.10%	98.90%	0.00%	0.07%	NA
Aus	269	13.80%	78.10%	4.46%	3.72%	NA
Indica I	595	96.00%	3.40%	0.67%	0.00%	NA
Indica II	465	91.20%	8.40%	0.43%	0.00%	NA
Indica III	913	91.90%	7.30%	0.66%	0.11%	NA
Indica Intermediate	786	83.10%	15.10%	1.15%	0.64%	NA
Temperate Japonica	767	0.70%	99.30%	0.00%	0.00%	NA
Tropical Japonica	504	2.00%	97.80%	0.00%	0.20%	NA
Japonica Intermediate	241	0.40%	99.60%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	31.10%	68.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1205555293	G -> DEL	N	N	silent_mutation	Average:12.499; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg1205555293	G -> T	LOC_Os12g10490.1	upstream_gene_variant ; 2844.0bp to feature; MODIFIER	silent_mutation	Average:12.499; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg1205555293	G -> T	LOC_Os12g10470.1	downstream_gene_variant ; 496.0bp to feature; MODIFIER	silent_mutation	Average:12.499; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg1205555293	G -> T	LOC_Os12g10480.1	downstream_gene_variant ; 610.0bp to feature; MODIFIER	silent_mutation	Average:12.499; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg1205555293	G -> T	LOC_Os12g10470-LOC_Os12g10480	intergenic_region ; MODIFIER	silent_mutation	Average:12.499; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1205555293	NA	6.59E-16	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205555293	NA	3.81E-08	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205555293	NA	5.03E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205555293	NA	1.33E-15	mr1914	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205555293	NA	2.45E-07	mr1613_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205555293	NA	1.23E-07	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251