\
| Variant ID: vg1205555293 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 5555293 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, T: 0.15, others allele: 0.00, population size: 168. )
GTGATGCGTGACAATGGCACTGTTATGAATTGCTTGCCAACAATGATTCCCAACAATTTGATATGCTGCAAACAGTGACAACCTCGTTTGATCAACTGCA[G/T]
AGTCCACCCATGTTCATGATTATGTCCATTTATTGGCATGCCAATTTCATCAGTCAAGCATATGCATTGCCCAGTAGATCCTAATGTATTTACCACCTAT
ATAGGTGGTAAATACATTAGGATCTACTGGGCAATGCATATGCTTGACTGATGAAATTGGCATGCCAATAAATGGACATAATCATGAACATGGGTGGACT[C/A]
TGCAGTTGATCAAACGAGGTTGTCACTGTTTGCAGCATATCAAATTGTTGGGAATCATTGTTGGCAAGCAATTCATAACAGTGCCATTGTCACGCATCAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.40% | 44.60% | 0.70% | 0.36% | NA |
| All Indica | 2759 | 90.10% | 8.90% | 0.76% | 0.22% | NA |
| All Japonica | 1512 | 1.10% | 98.90% | 0.00% | 0.07% | NA |
| Aus | 269 | 13.80% | 78.10% | 4.46% | 3.72% | NA |
| Indica I | 595 | 96.00% | 3.40% | 0.67% | 0.00% | NA |
| Indica II | 465 | 91.20% | 8.40% | 0.43% | 0.00% | NA |
| Indica III | 913 | 91.90% | 7.30% | 0.66% | 0.11% | NA |
| Indica Intermediate | 786 | 83.10% | 15.10% | 1.15% | 0.64% | NA |
| Temperate Japonica | 767 | 0.70% | 99.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.00% | 97.80% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 31.10% | 68.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1205555293 | G -> DEL | N | N | silent_mutation | Average:12.499; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| vg1205555293 | G -> T | LOC_Os12g10490.1 | upstream_gene_variant ; 2844.0bp to feature; MODIFIER | silent_mutation | Average:12.499; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| vg1205555293 | G -> T | LOC_Os12g10470.1 | downstream_gene_variant ; 496.0bp to feature; MODIFIER | silent_mutation | Average:12.499; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| vg1205555293 | G -> T | LOC_Os12g10480.1 | downstream_gene_variant ; 610.0bp to feature; MODIFIER | silent_mutation | Average:12.499; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| vg1205555293 | G -> T | LOC_Os12g10470-LOC_Os12g10480 | intergenic_region ; MODIFIER | silent_mutation | Average:12.499; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1205555293 | NA | 6.59E-16 | mr1164 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205555293 | NA | 3.81E-08 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205555293 | NA | 5.03E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205555293 | NA | 1.33E-15 | mr1914 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205555293 | NA | 2.45E-07 | mr1613_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205555293 | NA | 1.23E-07 | mr1914_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |