\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1205541281:

Variant ID: vg1205541281 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 5541281
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCCTTGTTTAGTTGGGAAAAATTTTTAGGTTTGGTTGTCATATCGGATATACGGACACACATTGAAGTATTAAACGTAGTTTAATAACAAAACAAATTA[T/C]
AGATTCCGCCAGGAAATTGCGAGATGAATTTATTAAGCCTAATTAATCTATCATTAGCAAATGTTTACTGTAGCACCACATTGTCAAATACTGACGCAAT

Reverse complement sequence

ATTGCGTCAGTATTTGACAATGTGGTGCTACAGTAAACATTTGCTAATGATAGATTAATTAGGCTTAATAAATTCATCTCGCAATTTCCTGGCGGAATCT[A/G]
TAATTTGTTTTGTTATTAAACTACGTTTAATACTTCAATGTGTGTCCGTATATCCGATATGACAACCAAACCTAAAAATTTTTCCCAACTAAACAAGGCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.10% 42.40% 0.66% 5.88% NA
All Indica  2759 25.10% 68.90% 0.83% 5.15% NA
All Japonica  1512 96.40% 3.60% 0.00% 0.00% NA
Aus  269 40.90% 8.20% 1.86% 49.07% NA
Indica I  595 62.40% 30.80% 0.84% 6.05% NA
Indica II  465 17.20% 77.40% 0.65% 4.73% NA
Indica III  913 3.20% 92.70% 0.44% 3.72% NA
Indica Intermediate  786 27.00% 65.30% 1.40% 6.36% NA
Temperate Japonica  767 95.40% 4.60% 0.00% 0.00% NA
Tropical Japonica  504 96.60% 3.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 0.00% 1.04% NA
Intermediate  90 70.00% 23.30% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1205541281 T -> C LOC_Os12g10440.1 upstream_gene_variant ; 4514.0bp to feature; MODIFIER silent_mutation Average:71.997; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg1205541281 T -> C LOC_Os12g10450.1 downstream_gene_variant ; 1268.0bp to feature; MODIFIER silent_mutation Average:71.997; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg1205541281 T -> C LOC_Os12g10460.1 downstream_gene_variant ; 2025.0bp to feature; MODIFIER silent_mutation Average:71.997; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg1205541281 T -> C LOC_Os12g10450-LOC_Os12g10460 intergenic_region ; MODIFIER silent_mutation Average:71.997; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg1205541281 T -> DEL N N silent_mutation Average:71.997; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1205541281 NA 5.59E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281 NA 2.20E-06 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281 NA 1.56E-18 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281 NA 3.71E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281 NA 3.24E-06 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281 8.33E-06 8.33E-06 mr1205 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281 NA 4.63E-15 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281 NA 6.63E-13 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281 4.21E-06 3.01E-06 mr1281 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281 NA 6.99E-07 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281 NA 7.32E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281 NA 1.85E-14 mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281 NA 2.07E-16 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281 NA 2.91E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281 NA 1.42E-11 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251