\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1205533524:

Variant ID: vg1205533524 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 5533524
Reference Allele: GAlternative Allele: T,GTAGCCGATTCCGACAATA,GTAGCCGATT
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


CGGCTGAGTCTGAGTCGAGCTAAATAAGTCGATGTAGCCGATTCCGACAATACGACTTGTATGCGACATCGGGTTCAAGTTGATGTGCTTCAAGATGATT[G/T,GTAGCCGATTCCGACAATA,GTAGCCGATT]
CCACGCATGGATAGAGTCCTGGGAAGGCAATTGTATCTATTAATTAGGATATTTTATGTAAATTCCTTATAGATAAGTGTGGGCAAAAGTCTGCCGCAAA

Reverse complement sequence

TTTGCGGCAGACTTTTGCCCACACTTATCTATAAGGAATTTACATAAAATATCCTAATTAATAGATACAATTGCCTTCCCAGGACTCTATCCATGCGTGG[C/A,TATTGTCGGAATCGGCTAC,AATCGGCTAC]
AATCATCTTGAAGCACATCAACTTGAACCCGATGTCGCATACAAGTCGTATTGTCGGAATCGGCTACATCGACTTATTTAGCTCGACTCAGACTCAGCCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.90% 11.80% 0.21% 0.02% NA
All Indica  2759 79.70% 19.90% 0.33% 0.04% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 41.70% 57.30% 1.01% 0.00% NA
Indica II  465 87.10% 12.50% 0.43% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 80.80% 19.00% 0.13% 0.13% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1205533524 G -> GTAGCCGATTCCGACAATA LOC_Os12g10430.1 downstream_gene_variant ; 4156.0bp to feature; MODIFIER N Average:48.51; most accessible tissue: Minghui63 flag leaf, score: 71.116 N N N N
vg1205533524 G -> GTAGCCGATTCCGACAATA LOC_Os12g10440.1 intron_variant ; MODIFIER N Average:48.51; most accessible tissue: Minghui63 flag leaf, score: 71.116 N N N N
vg1205533524 G -> GTAGCCGATT LOC_Os12g10430.1 downstream_gene_variant ; 4156.0bp to feature; MODIFIER N Average:48.51; most accessible tissue: Minghui63 flag leaf, score: 71.116 N N N N
vg1205533524 G -> GTAGCCGATT LOC_Os12g10440.1 intron_variant ; MODIFIER N Average:48.51; most accessible tissue: Minghui63 flag leaf, score: 71.116 N N N N
vg1205533524 G -> DEL N N silent_mutation Average:48.51; most accessible tissue: Minghui63 flag leaf, score: 71.116 N N N N
vg1205533524 G -> T LOC_Os12g10430.1 downstream_gene_variant ; 4155.0bp to feature; MODIFIER silent_mutation Average:48.51; most accessible tissue: Minghui63 flag leaf, score: 71.116 N N N N
vg1205533524 G -> T LOC_Os12g10440.1 intron_variant ; MODIFIER silent_mutation Average:48.51; most accessible tissue: Minghui63 flag leaf, score: 71.116 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1205533524 NA 2.64E-06 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205533524 NA 6.63E-06 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205533524 6.07E-06 1.83E-06 mr1283 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205533524 NA 1.78E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205533524 7.91E-06 7.91E-06 mr1306 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205533524 NA 6.44E-06 mr1306 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205533524 NA 8.57E-06 mr1414 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205533524 NA 6.77E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205533524 2.31E-06 2.31E-06 mr1521 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205533524 NA 3.32E-07 mr1570 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205533524 3.69E-06 NA mr1866 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205533524 4.68E-07 4.68E-07 mr1866 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251