\
| Variant ID: vg1205533524 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr12 | Position: 5533524 |
| Reference Allele: G | Alternative Allele: T,GTAGCCGATTCCGACAATA,GTAGCCGATT |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 92. )
CGGCTGAGTCTGAGTCGAGCTAAATAAGTCGATGTAGCCGATTCCGACAATACGACTTGTATGCGACATCGGGTTCAAGTTGATGTGCTTCAAGATGATT[G/T,GTAGCCGATTCCGACAATA,GTAGCCGATT]
CCACGCATGGATAGAGTCCTGGGAAGGCAATTGTATCTATTAATTAGGATATTTTATGTAAATTCCTTATAGATAAGTGTGGGCAAAAGTCTGCCGCAAA
TTTGCGGCAGACTTTTGCCCACACTTATCTATAAGGAATTTACATAAAATATCCTAATTAATAGATACAATTGCCTTCCCAGGACTCTATCCATGCGTGG[C/A,TATTGTCGGAATCGGCTAC,AATCGGCTAC]
AATCATCTTGAAGCACATCAACTTGAACCCGATGTCGCATACAAGTCGTATTGTCGGAATCGGCTACATCGACTTATTTAGCTCGACTCAGACTCAGCCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.90% | 11.80% | 0.21% | 0.02% | NA |
| All Indica | 2759 | 79.70% | 19.90% | 0.33% | 0.04% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 41.70% | 57.30% | 1.01% | 0.00% | NA |
| Indica II | 465 | 87.10% | 12.50% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 80.80% | 19.00% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 5.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1205533524 | G -> GTAGCCGATTCCGACAATA | LOC_Os12g10430.1 | downstream_gene_variant ; 4156.0bp to feature; MODIFIER | N | Average:48.51; most accessible tissue: Minghui63 flag leaf, score: 71.116 | N | N | N | N |
| vg1205533524 | G -> GTAGCCGATTCCGACAATA | LOC_Os12g10440.1 | intron_variant ; MODIFIER | N | Average:48.51; most accessible tissue: Minghui63 flag leaf, score: 71.116 | N | N | N | N |
| vg1205533524 | G -> GTAGCCGATT | LOC_Os12g10430.1 | downstream_gene_variant ; 4156.0bp to feature; MODIFIER | N | Average:48.51; most accessible tissue: Minghui63 flag leaf, score: 71.116 | N | N | N | N |
| vg1205533524 | G -> GTAGCCGATT | LOC_Os12g10440.1 | intron_variant ; MODIFIER | N | Average:48.51; most accessible tissue: Minghui63 flag leaf, score: 71.116 | N | N | N | N |
| vg1205533524 | G -> DEL | N | N | silent_mutation | Average:48.51; most accessible tissue: Minghui63 flag leaf, score: 71.116 | N | N | N | N |
| vg1205533524 | G -> T | LOC_Os12g10430.1 | downstream_gene_variant ; 4155.0bp to feature; MODIFIER | silent_mutation | Average:48.51; most accessible tissue: Minghui63 flag leaf, score: 71.116 | N | N | N | N |
| vg1205533524 | G -> T | LOC_Os12g10440.1 | intron_variant ; MODIFIER | silent_mutation | Average:48.51; most accessible tissue: Minghui63 flag leaf, score: 71.116 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1205533524 | NA | 2.64E-06 | mr1139 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205533524 | NA | 6.63E-06 | mr1145 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205533524 | 6.07E-06 | 1.83E-06 | mr1283 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205533524 | NA | 1.78E-08 | mr1301 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205533524 | 7.91E-06 | 7.91E-06 | mr1306 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205533524 | NA | 6.44E-06 | mr1306 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205533524 | NA | 8.57E-06 | mr1414 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205533524 | NA | 6.77E-06 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205533524 | 2.31E-06 | 2.31E-06 | mr1521 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205533524 | NA | 3.32E-07 | mr1570 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205533524 | 3.69E-06 | NA | mr1866 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205533524 | 4.68E-07 | 4.68E-07 | mr1866 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |