\
| Variant ID: vg1205533146 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 5533146 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 85. )
AGAAGTCGCCAAGGAATCGCCTTTACGCCTAGGAATCGCCTTTATGCCAGAGGAATCGCCGGGGAAGAGAGAGAAAAAGTTTCGCTTGAGCGGTGAAAAC[G/A]
GAGGTCATGGCGTGAGATTTCTCGGGGGTAACGGTTAGTATTTAAAGCGCTGGAATAACGGTCAAAAGTGGCGGAGTGCGAAACTTGCTCGGAGTCGGCT
AGCCGACTCCGAGCAAGTTTCGCACTCCGCCACTTTTGACCGTTATTCCAGCGCTTTAAATACTAACCGTTACCCCCGAGAAATCTCACGCCATGACCTC[C/T]
GTTTTCACCGCTCAAGCGAAACTTTTTCTCTCTCTTCCCCGGCGATTCCTCTGGCATAAAGGCGATTCCTAGGCGTAAAGGCGATTCCTTGGCGACTTCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.30% | 39.30% | 1.02% | 3.36% | NA |
| All Indica | 2759 | 30.60% | 66.10% | 0.83% | 2.46% | NA |
| All Japonica | 1512 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 58.00% | 1.50% | 8.55% | 31.97% | NA |
| Indica I | 595 | 72.80% | 25.40% | 0.67% | 1.18% | NA |
| Indica II | 465 | 20.20% | 78.70% | 0.65% | 0.43% | NA |
| Indica III | 913 | 5.80% | 90.40% | 0.99% | 2.85% | NA |
| Indica Intermediate | 786 | 33.60% | 61.30% | 0.89% | 4.20% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 74.40% | 18.90% | 2.22% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1205533146 | G -> DEL | N | N | silent_mutation | Average:47.948; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg1205533146 | G -> A | LOC_Os12g10430.1 | downstream_gene_variant ; 3777.0bp to feature; MODIFIER | silent_mutation | Average:47.948; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg1205533146 | G -> A | LOC_Os12g10440.1 | intron_variant ; MODIFIER | silent_mutation | Average:47.948; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1205533146 | NA | 3.67E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205533146 | NA | 5.73E-07 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205533146 | NA | 1.92E-06 | mr1285 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205533146 | NA | 1.74E-08 | mr1301 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205533146 | 3.57E-06 | 1.30E-07 | mr1511 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205533146 | NA | 9.32E-06 | mr1656 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205533146 | 4.54E-06 | 4.55E-06 | mr1673 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205533146 | NA | 1.81E-07 | mr1527_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |