\
| Variant ID: vg1205501586 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 5501586 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTACATATCTGCTGACTGGGTTTAACGGTTCTGGGAAATGGTTTTTGTTCAGCCCCCTACGTACATTTCAACTTTGCTGAAGAAGGTAAAGTTTTCGGAC[C/T]
AGTTGTATACATCACCCAGCATTTCATCATCTCCATCTCTCTCTTGTGCCACAAACATATTGTAGGACTAACATGGCATCTTCTGTACTAGTGTTTGCTG
CAGCAAACACTAGTACAGAAGATGCCATGTTAGTCCTACAATATGTTTGTGGCACAAGAGAGAGATGGAGATGATGAAATGCTGGGTGATGTATACAACT[G/A]
GTCCGAAAACTTTACCTTCTTCAGCAAAGTTGAAATGTACGTAGGGGGCTGAACAAAAACCATTTCCCAGAACCGTTAAACCCAGTCAGCAGATATGTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.30% | 0.50% | 0.38% | 0.80% | NA |
| All Indica | 2759 | 99.30% | 0.00% | 0.07% | 0.65% | NA |
| All Japonica | 1512 | 97.90% | 1.30% | 0.79% | 0.00% | NA |
| Aus | 269 | 91.40% | 0.00% | 1.12% | 7.43% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.00% | 0.22% | 0.22% | NA |
| Indica III | 913 | 98.70% | 0.00% | 0.00% | 1.31% | NA |
| Indica Intermediate | 786 | 99.20% | 0.00% | 0.13% | 0.64% | NA |
| Temperate Japonica | 767 | 96.10% | 2.60% | 1.30% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1205501586 | C -> DEL | N | N | silent_mutation | Average:56.497; most accessible tissue: Zhenshan97 young leaf, score: 79.507 | N | N | N | N |
| vg1205501586 | C -> T | LOC_Os12g10400.1 | 5_prime_UTR_variant ; 73.0bp to feature; MODIFIER | silent_mutation | Average:56.497; most accessible tissue: Zhenshan97 young leaf, score: 79.507 | N | N | N | N |
| vg1205501586 | C -> T | LOC_Os12g10390.1 | upstream_gene_variant ; 862.0bp to feature; MODIFIER | silent_mutation | Average:56.497; most accessible tissue: Zhenshan97 young leaf, score: 79.507 | N | N | N | N |
| vg1205501586 | C -> T | LOC_Os12g10380.1 | downstream_gene_variant ; 3537.0bp to feature; MODIFIER | silent_mutation | Average:56.497; most accessible tissue: Zhenshan97 young leaf, score: 79.507 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1205501586 | NA | 9.09E-06 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205501586 | 6.52E-06 | NA | mr1089_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205501586 | 3.63E-06 | 1.16E-06 | mr1129_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205501586 | NA | 9.45E-06 | mr1458_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205501586 | NA | 8.39E-06 | mr1735_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |