\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1205501586:

Variant ID: vg1205501586 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 5501586
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTACATATCTGCTGACTGGGTTTAACGGTTCTGGGAAATGGTTTTTGTTCAGCCCCCTACGTACATTTCAACTTTGCTGAAGAAGGTAAAGTTTTCGGAC[C/T]
AGTTGTATACATCACCCAGCATTTCATCATCTCCATCTCTCTCTTGTGCCACAAACATATTGTAGGACTAACATGGCATCTTCTGTACTAGTGTTTGCTG

Reverse complement sequence

CAGCAAACACTAGTACAGAAGATGCCATGTTAGTCCTACAATATGTTTGTGGCACAAGAGAGAGATGGAGATGATGAAATGCTGGGTGATGTATACAACT[G/A]
GTCCGAAAACTTTACCTTCTTCAGCAAAGTTGAAATGTACGTAGGGGGCTGAACAAAAACCATTTCCCAGAACCGTTAAACCCAGTCAGCAGATATGTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.30% 0.50% 0.38% 0.80% NA
All Indica  2759 99.30% 0.00% 0.07% 0.65% NA
All Japonica  1512 97.90% 1.30% 0.79% 0.00% NA
Aus  269 91.40% 0.00% 1.12% 7.43% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.00% 0.22% 0.22% NA
Indica III  913 98.70% 0.00% 0.00% 1.31% NA
Indica Intermediate  786 99.20% 0.00% 0.13% 0.64% NA
Temperate Japonica  767 96.10% 2.60% 1.30% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1205501586 C -> DEL N N silent_mutation Average:56.497; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N
vg1205501586 C -> T LOC_Os12g10400.1 5_prime_UTR_variant ; 73.0bp to feature; MODIFIER silent_mutation Average:56.497; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N
vg1205501586 C -> T LOC_Os12g10390.1 upstream_gene_variant ; 862.0bp to feature; MODIFIER silent_mutation Average:56.497; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N
vg1205501586 C -> T LOC_Os12g10380.1 downstream_gene_variant ; 3537.0bp to feature; MODIFIER silent_mutation Average:56.497; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1205501586 NA 9.09E-06 mr1028 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205501586 6.52E-06 NA mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205501586 3.63E-06 1.16E-06 mr1129_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205501586 NA 9.45E-06 mr1458_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205501586 NA 8.39E-06 mr1735_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251