\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1205465375:

Variant ID: vg1205465375 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 5465375
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 57. )

Flanking Sequence (100 bp) in Reference Genome:


GGACAATTACAAATTTACCACTAGTTTGAATCATTATTACAAAATTGCCATTAGAAAATTACAAAAATGCCACTGAAACTATCATTCGAGTGGCATCCTT[G/A]
TAATATTAAAAAATCAGTGGCAAATTTACAAATGCCCCCTACTAATATGTTGGCCTGTGGGTAGTGGGGCTCACGTATCAGTGACCACATCCCTCCGTCT

Reverse complement sequence

AGACGGAGGGATGTGGTCACTGATACGTGAGCCCCACTACCCACAGGCCAACATATTAGTAGGGGGCATTTGTAAATTTGCCACTGATTTTTTAATATTA[C/T]
AAGGATGCCACTCGAATGATAGTTTCAGTGGCATTTTTGTAATTTTCTAATGGCAATTTTGTAATAATGATTCAAACTAGTGGTAAATTTGTAATTGTCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.20% 39.20% 6.54% 9.04% NA
All Indica  2759 70.90% 6.60% 7.39% 15.19% NA
All Japonica  1512 7.00% 92.30% 0.53% 0.13% NA
Aus  269 20.40% 45.70% 33.46% 0.37% NA
Indica I  595 75.00% 2.50% 13.78% 8.74% NA
Indica II  465 73.10% 4.30% 4.73% 17.85% NA
Indica III  913 72.10% 6.00% 3.50% 18.40% NA
Indica Intermediate  786 65.00% 11.60% 8.65% 14.76% NA
Temperate Japonica  767 7.40% 92.00% 0.26% 0.26% NA
Tropical Japonica  504 4.20% 95.00% 0.79% 0.00% NA
Japonica Intermediate  241 11.60% 87.60% 0.83% 0.00% NA
VI/Aromatic  96 1.00% 94.80% 3.12% 1.04% NA
Intermediate  90 21.10% 70.00% 4.44% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1205465375 G -> DEL N N silent_mutation Average:47.13; most accessible tissue: Minghui63 root, score: 67.73 N N N N
vg1205465375 G -> A LOC_Os12g10330.1 downstream_gene_variant ; 3669.0bp to feature; MODIFIER silent_mutation Average:47.13; most accessible tissue: Minghui63 root, score: 67.73 N N N N
vg1205465375 G -> A LOC_Os12g10320-LOC_Os12g10330 intergenic_region ; MODIFIER silent_mutation Average:47.13; most accessible tissue: Minghui63 root, score: 67.73 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1205465375 NA 1.22E-28 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205465375 NA 1.73E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205465375 NA 3.25E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205465375 4.60E-06 2.06E-06 mr1375 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205465375 NA 3.92E-18 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205465375 NA 3.04E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251