\
| Variant ID: vg1205463941 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 5463941 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.02, others allele: 0.00, population size: 55. )
TGTCGTCGTGCGAGACCGTGCGCTCTCGCGCTTTCACCGTGCGATACCGTCCGTGACATCACGTCCGCGTCATTTTCGCGCAACGATTACGCGAGATCGA[C/T]
GGTATATTTCTGTAAAAAAATTTACATTCCGACTATTCTAAAAATATAATTGGATGAACAGTGTATTTTTAAATTTAATTCCTCGTCTTTGTATCCTACT
AGTAGGATACAAAGACGAGGAATTAAATTTAAAAATACACTGTTCATCCAATTATATTTTTAGAATAGTCGGAATGTAAATTTTTTTACAGAAATATACC[G/A]
TCGATCTCGCGTAATCGTTGCGCGAAAATGACGCGGACGTGATGTCACGGACGGTATCGCACGGTGAAAGCGCGAGAGCGCACGGTCTCGCACGACGACA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.80% | 39.00% | 6.01% | 7.22% | NA |
| All Indica | 2759 | 80.20% | 6.10% | 8.48% | 5.22% | NA |
| All Japonica | 1512 | 1.50% | 92.40% | 0.46% | 5.62% | NA |
| Aus | 269 | 0.70% | 47.20% | 12.27% | 39.78% | NA |
| Indica I | 595 | 89.70% | 2.20% | 5.38% | 2.69% | NA |
| Indica II | 465 | 72.90% | 4.10% | 13.33% | 9.68% | NA |
| Indica III | 913 | 81.40% | 5.90% | 8.21% | 4.49% | NA |
| Indica Intermediate | 786 | 75.80% | 10.60% | 8.27% | 5.34% | NA |
| Temperate Japonica | 767 | 1.20% | 92.20% | 0.13% | 6.52% | NA |
| Tropical Japonica | 504 | 2.80% | 95.00% | 0.79% | 1.39% | NA |
| Japonica Intermediate | 241 | 0.00% | 87.60% | 0.83% | 11.62% | NA |
| VI/Aromatic | 96 | 1.00% | 93.80% | 3.12% | 2.08% | NA |
| Intermediate | 90 | 21.10% | 67.80% | 7.78% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1205463941 | C -> DEL | N | N | silent_mutation | Average:15.181; most accessible tissue: Callus, score: 42.462 | N | N | N | N |
| vg1205463941 | C -> T | LOC_Os12g10320-LOC_Os12g10330 | intergenic_region ; MODIFIER | silent_mutation | Average:15.181; most accessible tissue: Callus, score: 42.462 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1205463941 | NA | 6.97E-08 | mr1040 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205463941 | 1.54E-06 | 4.55E-09 | mr1071 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205463941 | NA | 4.43E-07 | mr1080 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205463941 | 3.68E-06 | 6.75E-07 | mr1100 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205463941 | 3.62E-06 | 2.36E-07 | mr1140 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205463941 | 5.84E-07 | 3.65E-09 | mr1203 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205463941 | NA | 3.12E-11 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205463941 | 4.00E-07 | 7.84E-08 | mr1395 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205463941 | 3.75E-07 | 1.86E-08 | mr1618 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205463941 | NA | 1.63E-06 | mr1619 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205463941 | NA | 2.92E-07 | mr1100_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |