\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1205463941:

Variant ID: vg1205463941 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 5463941
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.02, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


TGTCGTCGTGCGAGACCGTGCGCTCTCGCGCTTTCACCGTGCGATACCGTCCGTGACATCACGTCCGCGTCATTTTCGCGCAACGATTACGCGAGATCGA[C/T]
GGTATATTTCTGTAAAAAAATTTACATTCCGACTATTCTAAAAATATAATTGGATGAACAGTGTATTTTTAAATTTAATTCCTCGTCTTTGTATCCTACT

Reverse complement sequence

AGTAGGATACAAAGACGAGGAATTAAATTTAAAAATACACTGTTCATCCAATTATATTTTTAGAATAGTCGGAATGTAAATTTTTTTACAGAAATATACC[G/A]
TCGATCTCGCGTAATCGTTGCGCGAAAATGACGCGGACGTGATGTCACGGACGGTATCGCACGGTGAAAGCGCGAGAGCGCACGGTCTCGCACGACGACA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.80% 39.00% 6.01% 7.22% NA
All Indica  2759 80.20% 6.10% 8.48% 5.22% NA
All Japonica  1512 1.50% 92.40% 0.46% 5.62% NA
Aus  269 0.70% 47.20% 12.27% 39.78% NA
Indica I  595 89.70% 2.20% 5.38% 2.69% NA
Indica II  465 72.90% 4.10% 13.33% 9.68% NA
Indica III  913 81.40% 5.90% 8.21% 4.49% NA
Indica Intermediate  786 75.80% 10.60% 8.27% 5.34% NA
Temperate Japonica  767 1.20% 92.20% 0.13% 6.52% NA
Tropical Japonica  504 2.80% 95.00% 0.79% 1.39% NA
Japonica Intermediate  241 0.00% 87.60% 0.83% 11.62% NA
VI/Aromatic  96 1.00% 93.80% 3.12% 2.08% NA
Intermediate  90 21.10% 67.80% 7.78% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1205463941 C -> DEL N N silent_mutation Average:15.181; most accessible tissue: Callus, score: 42.462 N N N N
vg1205463941 C -> T LOC_Os12g10320-LOC_Os12g10330 intergenic_region ; MODIFIER silent_mutation Average:15.181; most accessible tissue: Callus, score: 42.462 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1205463941 NA 6.97E-08 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205463941 1.54E-06 4.55E-09 mr1071 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205463941 NA 4.43E-07 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205463941 3.68E-06 6.75E-07 mr1100 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205463941 3.62E-06 2.36E-07 mr1140 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205463941 5.84E-07 3.65E-09 mr1203 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205463941 NA 3.12E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205463941 4.00E-07 7.84E-08 mr1395 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205463941 3.75E-07 1.86E-08 mr1618 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205463941 NA 1.63E-06 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205463941 NA 2.92E-07 mr1100_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251