\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1205430972:

Variant ID: vg1205430972 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 5430972
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACTATTTTTTCTATAAACTTGTCAAACTTAAAGCAGTTTGACTTTTACTAGAGGCAAAACGTCTTATAGCCTGAAATAGAGGGATTTCTTTAATTTTAT[C/T]
GGGAAAAAATCCAGAAGAAACGTACATATATACAGAGGCATGAGAGAAAGAATACTAGGTGAAAGGAATGCACATAGACAACATGATTTTTTCCATATCC

Reverse complement sequence

GGATATGGAAAAAATCATGTTGTCTATGTGCATTCCTTTCACCTAGTATTCTTTCTCTCATGCCTCTGTATATATGTACGTTTCTTCTGGATTTTTTCCC[G/A]
ATAAAATTAAAGAAATCCCTCTATTTCAGGCTATAAGACGTTTTGCCTCTAGTAAAAGTCAAACTGCTTTAAGTTTGACAAGTTTATAGAAAAAATAGTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.70% 1.70% 22.01% 34.68% NA
All Indica  2759 12.00% 2.50% 36.46% 49.04% NA
All Japonica  1512 94.60% 0.00% 0.53% 4.89% NA
Aus  269 19.70% 2.60% 6.69% 71.00% NA
Indica I  595 7.40% 1.80% 22.69% 68.07% NA
Indica II  465 19.10% 0.00% 40.00% 40.86% NA
Indica III  913 9.90% 4.50% 47.21% 38.44% NA
Indica Intermediate  786 13.60% 2.30% 32.32% 51.78% NA
Temperate Japonica  767 96.50% 0.00% 0.13% 3.39% NA
Tropical Japonica  504 95.00% 0.00% 1.19% 3.77% NA
Japonica Intermediate  241 87.60% 0.00% 0.41% 12.03% NA
VI/Aromatic  96 92.70% 0.00% 1.04% 6.25% NA
Intermediate  90 74.40% 1.10% 7.78% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1205430972 C -> DEL N N silent_mutation Average:16.601; most accessible tissue: Callus, score: 33.695 N N N N
vg1205430972 C -> T LOC_Os12g10270.1 upstream_gene_variant ; 1603.0bp to feature; MODIFIER silent_mutation Average:16.601; most accessible tissue: Callus, score: 33.695 N N N N
vg1205430972 C -> T LOC_Os12g10280.1 upstream_gene_variant ; 4991.0bp to feature; MODIFIER silent_mutation Average:16.601; most accessible tissue: Callus, score: 33.695 N N N N
vg1205430972 C -> T LOC_Os12g10260-LOC_Os12g10270 intergenic_region ; MODIFIER silent_mutation Average:16.601; most accessible tissue: Callus, score: 33.695 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1205430972 NA 5.80E-07 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972 NA 3.84E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972 NA 1.09E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972 NA 2.06E-08 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972 NA 3.83E-06 mr1391_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972 NA 8.53E-07 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972 NA 1.56E-16 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972 NA 4.32E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972 NA 4.21E-07 mr1790_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972 NA 2.43E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972 NA 1.09E-10 mr1805_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972 NA 1.97E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972 NA 4.50E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972 NA 8.27E-07 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972 NA 4.68E-06 mr1901_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972 NA 8.96E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972 NA 4.02E-08 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251