Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1205430972:

Variant ID: vg1205430972 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 5430972
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACTATTTTTTCTATAAACTTGTCAAACTTAAAGCAGTTTGACTTTTACTAGAGGCAAAACGTCTTATAGCCTGAAATAGAGGGATTTCTTTAATTTTAT[C/T]
GGGAAAAAATCCAGAAGAAACGTACATATATACAGAGGCATGAGAGAAAGAATACTAGGTGAAAGGAATGCACATAGACAACATGATTTTTTCCATATCC

Reverse complement sequence

GGATATGGAAAAAATCATGTTGTCTATGTGCATTCCTTTCACCTAGTATTCTTTCTCTCATGCCTCTGTATATATGTACGTTTCTTCTGGATTTTTTCCC[G/A]
ATAAAATTAAAGAAATCCCTCTATTTCAGGCTATAAGACGTTTTGCCTCTAGTAAAAGTCAAACTGCTTTAAGTTTGACAAGTTTATAGAAAAAATAGTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.70%	1.70%	22.01%	34.68%	NA
All Indica	2759	12.00%	2.50%	36.46%	49.04%	NA
All Japonica	1512	94.60%	0.00%	0.53%	4.89%	NA
Aus	269	19.70%	2.60%	6.69%	71.00%	NA
Indica I	595	7.40%	1.80%	22.69%	68.07%	NA
Indica II	465	19.10%	0.00%	40.00%	40.86%	NA
Indica III	913	9.90%	4.50%	47.21%	38.44%	NA
Indica Intermediate	786	13.60%	2.30%	32.32%	51.78%	NA
Temperate Japonica	767	96.50%	0.00%	0.13%	3.39%	NA
Tropical Japonica	504	95.00%	0.00%	1.19%	3.77%	NA
Japonica Intermediate	241	87.60%	0.00%	0.41%	12.03%	NA
VI/Aromatic	96	92.70%	0.00%	1.04%	6.25%	NA
Intermediate	90	74.40%	1.10%	7.78%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1205430972	C -> DEL	N	N	silent_mutation	Average:16.601; most accessible tissue: Callus, score: 33.695	N	N	N	N
vg1205430972	C -> T	LOC_Os12g10270.1	upstream_gene_variant ; 1603.0bp to feature; MODIFIER	silent_mutation	Average:16.601; most accessible tissue: Callus, score: 33.695	N	N	N	N
vg1205430972	C -> T	LOC_Os12g10280.1	upstream_gene_variant ; 4991.0bp to feature; MODIFIER	silent_mutation	Average:16.601; most accessible tissue: Callus, score: 33.695	N	N	N	N
vg1205430972	C -> T	LOC_Os12g10260-LOC_Os12g10270	intergenic_region ; MODIFIER	silent_mutation	Average:16.601; most accessible tissue: Callus, score: 33.695	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1205430972	NA	5.80E-07	mr1457	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972	NA	3.84E-07	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972	NA	1.09E-08	mr1514	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972	NA	2.06E-08	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972	NA	3.83E-06	mr1391_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972	NA	8.53E-07	mr1562_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972	NA	1.56E-16	mr1592_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972	NA	4.32E-08	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972	NA	4.21E-07	mr1790_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972	NA	2.43E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972	NA	1.09E-10	mr1805_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972	NA	1.97E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972	NA	4.50E-08	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972	NA	8.27E-07	mr1842_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972	NA	4.68E-06	mr1901_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972	NA	8.96E-09	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205430972	NA	4.02E-08	mr1915_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251