Variant ID: vg1205331763 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 5331763 |
Reference Allele: T | Alternative Allele: C,A |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 76. )
ATTTTAGCTTTGATTTTTGATCTTCGATGGCTTTGGGCAGATCGGCAAGCTTCTGTTCTTCAAGGGCAATCTGTGCACTGCATTGCTCCAATTCAGCTAG[T/C,A]
AGTTTTATCTGCCGAGTGTTCAGCCGATCGATGTTGGCTTGAGTAGAACTTGGACCAGCTTCCAACTCATCAAGTTTTGCTTTTTCCTCATTGATAGAGG
CCTCTATCAATGAGGAAAAAGCAAAACTTGATGAGTTGGAAGCTGGTCCAAGTTCTACTCAAGCCAACATCGATCGGCTGAACACTCGGCAGATAAAACT[A/G,T]
CTAGCTGAATTGGAGCAATGCAGTGCACAGATTGCCCTTGAAGAACAGAAGCTTGCCGATCTGCCCAAAGCCATCGAAGATCAAAAATCAAAGCTAAAAT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 23.70% | 11.20% | 6.96% | 55.78% | A: 2.45% |
All Indica | 2759 | 4.10% | 0.70% | 6.89% | 84.23% | A: 4.13% |
All Japonica | 1512 | 54.30% | 32.50% | 7.94% | 5.29% | NA |
Aus | 269 | 19.70% | 0.40% | 2.60% | 76.58% | A: 0.74% |
Indica I | 595 | 3.70% | 0.30% | 11.60% | 81.68% | A: 2.69% |
Indica II | 465 | 3.40% | 1.50% | 9.89% | 81.94% | A: 3.23% |
Indica III | 913 | 2.30% | 0.30% | 2.85% | 87.84% | A: 6.68% |
Indica Intermediate | 786 | 6.70% | 0.90% | 6.23% | 83.33% | A: 2.80% |
Temperate Japonica | 767 | 32.10% | 54.00% | 10.30% | 3.65% | NA |
Tropical Japonica | 504 | 87.70% | 4.20% | 3.17% | 4.96% | NA |
Japonica Intermediate | 241 | 55.20% | 23.20% | 10.37% | 11.20% | NA |
VI/Aromatic | 96 | 93.80% | 0.00% | 3.12% | 3.12% | NA |
Intermediate | 90 | 46.70% | 17.80% | 10.00% | 25.56% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1205331763 | T -> C | LOC_Os12g10070.1 | synonymous_variant ; p.Leu595Leu; LOW | synonymous_codon | Average:17.391; most accessible tissue: Callus, score: 72.532 | N | N | N | N |
vg1205331763 | T -> DEL | LOC_Os12g10070.1 | N | frameshift_variant | Average:17.391; most accessible tissue: Callus, score: 72.532 | N | N | N | N |
vg1205331763 | T -> A | LOC_Os12g10070.1 | synonymous_variant ; p.Leu595Leu; LOW | synonymous_codon | Average:17.391; most accessible tissue: Callus, score: 72.532 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1205331763 | NA | 3.50E-06 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1205331763 | 2.58E-09 | NA | mr1354 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1205331763 | 3.72E-06 | NA | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1205331763 | NA | 1.05E-12 | mr1441 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1205331763 | NA | 4.91E-06 | mr1441 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1205331763 | NA | 2.91E-06 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1205331763 | NA | 1.37E-10 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1205331763 | NA | 2.01E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1205331763 | NA | 9.71E-06 | mr1159_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1205331763 | NA | 7.29E-06 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1205331763 | NA | 9.05E-06 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1205331763 | NA | 1.22E-07 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |