\
| Variant ID: vg1205242086 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 5242086 |
| Reference Allele: C | Alternative Allele: T,G |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, G: 0.01, others allele: 0.00, population size: 72. )
CTGAGAAATCTACTTATATTGCATAAATCAAAAGTGTTGCCAAAATATATATATTACAATATTGTTTTACATTGTCACTTTAAATAACGTCATCTAGTTA[C/T,G]
ATTATGGCATAGTAGTGTTCCACTCCTGAAGATCCTTGAATTCGTCACTTGCCGCTAGGGCACCCTCTGGGTCGAAGAAATCTCCTTTGACATGACAGCA
TGCTGTCATGTCAAAGGAGATTTCTTCGACCCAGAGGGTGCCCTAGCGGCAAGTGACGAATTCAAGGATCTTCAGGAGTGGAACACTACTATGCCATAAT[G/A,C]
TAACTAGATGACGTTATTTAAAGTGACAATGTAAAACAATATTGTAATATATATATTTTGGCAACACTTTTGATTTATGCAATATAAGTAGATTTCTCAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.70% | 2.70% | 8.04% | 33.52% | G: 0.02% |
| All Indica | 2759 | 31.10% | 4.30% | 11.42% | 53.21% | NA |
| All Japonica | 1512 | 97.80% | 0.00% | 0.60% | 1.52% | G: 0.07% |
| Aus | 269 | 48.00% | 2.60% | 20.07% | 29.37% | NA |
| Indica I | 595 | 54.80% | 3.20% | 6.55% | 35.46% | NA |
| Indica II | 465 | 33.80% | 1.90% | 6.24% | 58.06% | NA |
| Indica III | 913 | 8.90% | 5.90% | 19.06% | 66.16% | NA |
| Indica Intermediate | 786 | 37.30% | 4.70% | 9.29% | 48.73% | NA |
| Temperate Japonica | 767 | 98.40% | 0.00% | 0.65% | 0.78% | G: 0.13% |
| Tropical Japonica | 504 | 97.60% | 0.00% | 0.20% | 2.18% | NA |
| Japonica Intermediate | 241 | 96.30% | 0.00% | 1.24% | 2.49% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 83.30% | 2.20% | 1.11% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1205242086 | C -> DEL | N | N | silent_mutation | Average:11.764; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg1205242086 | C -> G | LOC_Os12g09880.1 | downstream_gene_variant ; 1760.0bp to feature; MODIFIER | silent_mutation | Average:11.764; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg1205242086 | C -> G | LOC_Os12g09890.1 | downstream_gene_variant ; 2.0bp to feature; MODIFIER | silent_mutation | Average:11.764; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg1205242086 | C -> G | LOC_Os12g09880-LOC_Os12g09890 | intergenic_region ; MODIFIER | silent_mutation | Average:11.764; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg1205242086 | C -> T | LOC_Os12g09880.1 | downstream_gene_variant ; 1760.0bp to feature; MODIFIER | silent_mutation | Average:11.764; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg1205242086 | C -> T | LOC_Os12g09890.1 | downstream_gene_variant ; 2.0bp to feature; MODIFIER | silent_mutation | Average:11.764; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg1205242086 | C -> T | LOC_Os12g09880-LOC_Os12g09890 | intergenic_region ; MODIFIER | silent_mutation | Average:11.764; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1205242086 | 4.51E-06 | 6.56E-09 | mr1040 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205242086 | NA | 3.91E-06 | mr1508 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205242086 | NA | 1.24E-16 | mr1040_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205242086 | 1.83E-06 | NA | mr1167_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205242086 | NA | 1.12E-21 | mr1362_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205242086 | NA | 4.82E-19 | mr1581_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205242086 | NA | 1.84E-22 | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205242086 | NA | 3.50E-17 | mr1836_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205242086 | NA | 5.97E-06 | mr1914_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |