\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1205242086:

Variant ID: vg1205242086 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 5242086
Reference Allele: CAlternative Allele: T,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, G: 0.01, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


CTGAGAAATCTACTTATATTGCATAAATCAAAAGTGTTGCCAAAATATATATATTACAATATTGTTTTACATTGTCACTTTAAATAACGTCATCTAGTTA[C/T,G]
ATTATGGCATAGTAGTGTTCCACTCCTGAAGATCCTTGAATTCGTCACTTGCCGCTAGGGCACCCTCTGGGTCGAAGAAATCTCCTTTGACATGACAGCA

Reverse complement sequence

TGCTGTCATGTCAAAGGAGATTTCTTCGACCCAGAGGGTGCCCTAGCGGCAAGTGACGAATTCAAGGATCTTCAGGAGTGGAACACTACTATGCCATAAT[G/A,C]
TAACTAGATGACGTTATTTAAAGTGACAATGTAAAACAATATTGTAATATATATATTTTGGCAACACTTTTGATTTATGCAATATAAGTAGATTTCTCAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.70% 2.70% 8.04% 33.52% G: 0.02%
All Indica  2759 31.10% 4.30% 11.42% 53.21% NA
All Japonica  1512 97.80% 0.00% 0.60% 1.52% G: 0.07%
Aus  269 48.00% 2.60% 20.07% 29.37% NA
Indica I  595 54.80% 3.20% 6.55% 35.46% NA
Indica II  465 33.80% 1.90% 6.24% 58.06% NA
Indica III  913 8.90% 5.90% 19.06% 66.16% NA
Indica Intermediate  786 37.30% 4.70% 9.29% 48.73% NA
Temperate Japonica  767 98.40% 0.00% 0.65% 0.78% G: 0.13%
Tropical Japonica  504 97.60% 0.00% 0.20% 2.18% NA
Japonica Intermediate  241 96.30% 0.00% 1.24% 2.49% NA
VI/Aromatic  96 96.90% 0.00% 1.04% 2.08% NA
Intermediate  90 83.30% 2.20% 1.11% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1205242086 C -> DEL N N silent_mutation Average:11.764; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg1205242086 C -> G LOC_Os12g09880.1 downstream_gene_variant ; 1760.0bp to feature; MODIFIER silent_mutation Average:11.764; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg1205242086 C -> G LOC_Os12g09890.1 downstream_gene_variant ; 2.0bp to feature; MODIFIER silent_mutation Average:11.764; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg1205242086 C -> G LOC_Os12g09880-LOC_Os12g09890 intergenic_region ; MODIFIER silent_mutation Average:11.764; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg1205242086 C -> T LOC_Os12g09880.1 downstream_gene_variant ; 1760.0bp to feature; MODIFIER silent_mutation Average:11.764; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg1205242086 C -> T LOC_Os12g09890.1 downstream_gene_variant ; 2.0bp to feature; MODIFIER silent_mutation Average:11.764; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg1205242086 C -> T LOC_Os12g09880-LOC_Os12g09890 intergenic_region ; MODIFIER silent_mutation Average:11.764; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1205242086 4.51E-06 6.56E-09 mr1040 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205242086 NA 3.91E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205242086 NA 1.24E-16 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205242086 1.83E-06 NA mr1167_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205242086 NA 1.12E-21 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205242086 NA 4.82E-19 mr1581_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205242086 NA 1.84E-22 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205242086 NA 3.50E-17 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205242086 NA 5.97E-06 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251