\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1205231991:

Variant ID: vg1205231991 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 5231991
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, A: 0.11, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


TTTAATTTCCCTAACTGGAGAAAGATTAAGCTATGTGCTTTGGATACATTTTTCGGCATCCCACAACGTCGCCGAGTATGAGGCGCTCCTTCATGGACTG[A/C]
GGATTGCGATTTCCCTAGGGATAAAGCGTCTAATAGTTCGAGGCGATTCACAGCTGGTCGTCAACCAAGTTATGAAAGAGTGGTCCTGCCTTGACGACAA

Reverse complement sequence

TTGTCGTCAAGGCAGGACCACTCTTTCATAACTTGGTTGACGACCAGCTGTGAATCGCCTCGAACTATTAGACGCTTTATCCCTAGGGAAATCGCAATCC[T/G]
CAGTCCATGAAGGAGCGCCTCATACTCGGCGACGTTGTGGGATGCCGAAAAATGTATCCAAAGCACATAGCTTAATCTTTCTCCAGTTAGGGAAATTAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.50% 16.00% 26.17% 1.33% NA
All Indica  2759 32.10% 26.90% 39.83% 1.16% NA
All Japonica  1512 98.70% 0.10% 1.26% 0.00% NA
Aus  269 47.60% 3.70% 37.17% 11.52% NA
Indica I  595 58.50% 17.80% 23.36% 0.34% NA
Indica II  465 34.60% 15.90% 47.53% 1.94% NA
Indica III  913 8.80% 42.20% 47.86% 1.20% NA
Indica Intermediate  786 37.80% 22.50% 38.42% 1.27% NA
Temperate Japonica  767 99.00% 0.10% 0.91% 0.00% NA
Tropical Japonica  504 98.00% 0.00% 1.98% 0.00% NA
Japonica Intermediate  241 99.20% 0.00% 0.83% 0.00% NA
VI/Aromatic  96 95.80% 0.00% 4.17% 0.00% NA
Intermediate  90 77.80% 5.60% 16.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1205231991 A -> C LOC_Os12g09860.1 synonymous_variant ; p.Arg1495Arg; LOW synonymous_codon Average:13.397; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg1205231991 A -> DEL LOC_Os12g09860.1 N frameshift_variant Average:13.397; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1205231991 NA 8.37E-10 mr1040 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205231991 NA 5.87E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205231991 NA 6.30E-06 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205231991 NA 8.03E-18 mr1040_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205231991 NA 4.45E-09 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205231991 NA 1.69E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205231991 NA 1.84E-12 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205231991 NA 3.19E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205231991 NA 3.38E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205231991 NA 9.27E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205231991 NA 1.89E-06 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205231991 NA 4.78E-08 mr1671_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205231991 NA 1.64E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205231991 NA 5.27E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205231991 NA 7.17E-10 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205231991 NA 2.03E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205231991 NA 5.69E-09 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205231991 NA 4.71E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205231991 NA 1.61E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205231991 NA 3.81E-06 mr1901_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205231991 NA 1.76E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205231991 NA 3.70E-16 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205231991 NA 5.08E-09 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251