\
| Variant ID: vg1205231921 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 5231921 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, others allele: 0.00, population size: 49. )
AGAAGATGGAGCACTGGACCATGCATTTTGACGGATCAAAACGACTTTCGGGTACTGGAGCAGGAGTGGTTTTAATTTCCCTAACTGGAGAAAGATTAAG[C/T]
TATGTGCTTTGGATACATTTTTCGGCATCCCACAACGTCGCCGAGTATGAGGCGCTCCTTCATGGACTGAGGATTGCGATTTCCCTAGGGATAAAGCGTC
GACGCTTTATCCCTAGGGAAATCGCAATCCTCAGTCCATGAAGGAGCGCCTCATACTCGGCGACGTTGTGGGATGCCGAAAAATGTATCCAAAGCACATA[G/A]
CTTAATCTTTCTCCAGTTAGGGAAATTAAAACCACTCCTGCTCCAGTACCCGAAAGTCGTTTTGATCCGTCAAAATGCATGGTCCAGTGCTCCATCTTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.20% | 3.00% | 15.87% | 9.94% | NA |
| All Indica | 2759 | 54.00% | 5.00% | 25.88% | 15.15% | NA |
| All Japonica | 1512 | 99.70% | 0.10% | 0.00% | 0.26% | NA |
| Aus | 269 | 72.10% | 0.70% | 10.78% | 16.36% | NA |
| Indica I | 595 | 72.10% | 0.50% | 17.14% | 10.25% | NA |
| Indica II | 465 | 46.90% | 16.10% | 20.43% | 16.56% | NA |
| Indica III | 913 | 41.20% | 1.50% | 37.79% | 19.50% | NA |
| Indica Intermediate | 786 | 59.30% | 5.90% | 21.88% | 12.98% | NA |
| Temperate Japonica | 767 | 99.50% | 0.00% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 2.20% | 5.56% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1205231921 | C -> DEL | LOC_Os12g09860.1 | N | frameshift_variant | Average:11.953; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg1205231921 | C -> T | LOC_Os12g09860.1 | synonymous_variant ; p.Ser1471Ser; LOW | synonymous_codon | Average:11.953; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1205231921 | NA | 7.43E-06 | mr1122 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205231921 | 3.95E-08 | 3.16E-14 | mr1889 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205231921 | 4.13E-07 | NA | mr1896 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205231921 | 3.16E-08 | 1.21E-13 | mr1896 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205231921 | NA | 4.13E-11 | mr1903 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205231921 | 4.16E-08 | NA | mr1907 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205231921 | 1.02E-09 | 3.20E-17 | mr1907 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205231921 | 3.21E-06 | 3.21E-06 | mr1926 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205231921 | 5.02E-06 | NA | mr1934 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205231921 | 1.55E-06 | 1.04E-13 | mr1934 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205231921 | 4.36E-08 | NA | mr1935 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205231921 | 8.23E-07 | 2.14E-11 | mr1935 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205231921 | NA | 2.21E-07 | mr1896_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |