\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1205136836:

Variant ID: vg1205136836 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 5136836
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAACAGGCTCGTCTTAATTCAAGCGGAGGTGATGCTCCATAAAATAAATCACAAAATCCTTTTAAAAAAAGAGTCACAAATTCACATCATAGAATATGC[T/C]
GATGGATTGAGAGTAGGGAGATGGGAGAGGGAGAGAGGAAGCCAAATGGATAAGGACAGGGAGAGTGAGAGAGGTGAATGGTTAAGGTCGGTTTCTTATC

Reverse complement sequence

GATAAGAAACCGACCTTAACCATTCACCTCTCTCACTCTCCCTGTCCTTATCCATTTGGCTTCCTCTCTCCCTCTCCCATCTCCCTACTCTCAATCCATC[A/G]
GCATATTCTATGATGTGAATTTGTGACTCTTTTTTTAAAAGGATTTTGTGATTTATTTTATGGAGCATCACCTCCGCTTGAATTAAGACGAGCCTGTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.00% 44.80% 0.13% 0.00% NA
All Indica  2759 92.40% 7.40% 0.22% 0.00% NA
All Japonica  1512 1.50% 98.50% 0.00% 0.00% NA
Aus  269 0.40% 99.60% 0.00% 0.00% NA
Indica I  595 97.00% 2.70% 0.34% 0.00% NA
Indica II  465 96.10% 3.70% 0.22% 0.00% NA
Indica III  913 92.80% 7.10% 0.11% 0.00% NA
Indica Intermediate  786 86.40% 13.40% 0.25% 0.00% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 2.60% 97.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 28.90% 71.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1205136836 T -> C LOC_Os12g09720.1 upstream_gene_variant ; 1590.0bp to feature; MODIFIER silent_mutation Average:40.778; most accessible tissue: Callus, score: 74.068 N N N N
vg1205136836 T -> C LOC_Os12g09739.1 downstream_gene_variant ; 771.0bp to feature; MODIFIER silent_mutation Average:40.778; most accessible tissue: Callus, score: 74.068 N N N N
vg1205136836 T -> C LOC_Os12g09720-LOC_Os12g09739 intergenic_region ; MODIFIER silent_mutation Average:40.778; most accessible tissue: Callus, score: 74.068 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1205136836 NA 1.50E-35 mr1094 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205136836 NA 4.59E-35 mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205136836 NA 9.62E-13 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205136836 NA 6.33E-30 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205136836 NA 2.94E-16 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205136836 3.92E-07 6.17E-08 mr1280 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205136836 NA 1.19E-10 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205136836 NA 5.17E-10 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205136836 9.36E-06 4.71E-06 mr1318 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205136836 NA 1.85E-08 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205136836 NA 4.71E-10 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205136836 NA 3.64E-44 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205136836 NA 3.92E-18 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205136836 NA 1.88E-11 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205136836 NA 4.75E-17 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205136836 NA 3.81E-13 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205136836 NA 4.24E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205136836 NA 3.08E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205136836 NA 5.25E-09 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205136836 NA 2.47E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205136836 NA 8.84E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205136836 NA 3.84E-17 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205136836 NA 1.86E-07 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251