\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204986534:

Variant ID: vg1204986534 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4986534
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATTAGCCATAAATGCTACAATAGTAACCCACATGTGCTAATGACGGATTAATTAGGCTCAAAAGATTCGTCTCAAGGTTTCCAGGCGAGTTATGAAATT[A/G]
TTTTTTTCATTCGTATCCGAAAAACCCTTCCGACATCCGATTAAACATCTGATGTGACACAAAAATTTTCTTTTCGTGAACTAAATAGGCCCATACTCCA

Reverse complement sequence

TGGAGTATGGGCCTATTTAGTTCACGAAAAGAAAATTTTTGTGTCACATCAGATGTTTAATCGGATGTCGGAAGGGTTTTTCGGATACGAATGAAAAAAA[T/C]
AATTTCATAACTCGCCTGGAAACCTTGAGACGAATCTTTTGAGCCTAATTAATCCGTCATTAGCACATGTGGGTTACTATTGTAGCATTTATGGCTAATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.00% 45.70% 0.04% 0.32% NA
All Indica  2759 90.40% 9.50% 0.07% 0.04% NA
All Japonica  1512 1.50% 98.50% 0.00% 0.00% NA
Aus  269 1.90% 93.30% 0.00% 4.83% NA
Indica I  595 90.40% 9.40% 0.17% 0.00% NA
Indica II  465 93.80% 6.20% 0.00% 0.00% NA
Indica III  913 94.40% 5.50% 0.11% 0.00% NA
Indica Intermediate  786 83.80% 16.00% 0.00% 0.13% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 2.60% 97.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 25.60% 73.30% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204986534 A -> DEL N N silent_mutation Average:71.383; most accessible tissue: Minghui63 young leaf, score: 85.633 N N N N
vg1204986534 A -> G LOC_Os12g09500.1 intron_variant ; MODIFIER silent_mutation Average:71.383; most accessible tissue: Minghui63 young leaf, score: 85.633 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1204986534 A G -0.02 -0.03 -0.03 -0.02 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204986534 NA 3.69E-27 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204986534 NA 5.10E-07 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204986534 NA 2.36E-30 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204986534 NA 7.56E-09 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204986534 NA 3.96E-14 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204986534 NA 2.03E-07 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204986534 NA 9.02E-25 mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204986534 NA 1.56E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204986534 NA 1.36E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204986534 NA 9.32E-12 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204986534 NA 9.68E-11 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204986534 2.49E-06 NA mr1219_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204986534 1.76E-06 6.00E-14 mr1219_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204986534 NA 1.33E-09 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251