\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204930683:

Variant ID: vg1204930683 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4930683
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.66, A: 0.33, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


GTGGCTGAGAGAAGAGACCCTTGAAAATGGCTCATTTTCATGATGTACTTCTCTTCTATTCTGCATGGTAGGATGGCTTATGCCTTAATGTGGTCCTAGT[A/G]
GCTTTTCTAAGCAGAGATGTTGACCTGCAGAACATCTCAGAAGGAACACACCTATATGAGTTCGACTGCTAGTCACAGTCTATGAGATTTGGACGATCTC

Reverse complement sequence

GAGATCGTCCAAATCTCATAGACTGTGACTAGCAGTCGAACTCATATAGGTGTGTTCCTTCTGAGATGTTCTGCAGGTCAACATCTCTGCTTAGAAAAGC[T/C]
ACTAGGACCACATTAAGGCATAAGCCATCCTACCATGCAGAATAGAAGAGAAGTACATCATGAAAATGAGCCATTTTCAAGGGTCTCTTCTCTCAGCCAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.30% 16.40% 15.04% 29.28% NA
All Indica  2759 10.40% 15.20% 25.15% 49.22% NA
All Japonica  1512 90.80% 7.90% 0.66% 0.66% NA
Aus  269 13.80% 85.90% 0.00% 0.37% NA
Indica I  595 15.10% 11.30% 26.39% 47.23% NA
Indica II  465 8.80% 13.80% 27.10% 50.32% NA
Indica III  913 6.20% 15.80% 25.41% 52.57% NA
Indica Intermediate  786 12.70% 18.30% 22.77% 46.18% NA
Temperate Japonica  767 95.70% 3.50% 0.13% 0.65% NA
Tropical Japonica  504 94.00% 3.40% 1.59% 0.99% NA
Japonica Intermediate  241 68.50% 31.10% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 71.10% 5.60% 6.67% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204930683 A -> DEL N N silent_mutation Average:15.626; most accessible tissue: Callus, score: 20.564 N N N N
vg1204930683 A -> G LOC_Os12g09410.1 upstream_gene_variant ; 1019.0bp to feature; MODIFIER silent_mutation Average:15.626; most accessible tissue: Callus, score: 20.564 N N N N
vg1204930683 A -> G LOC_Os12g09400.1 downstream_gene_variant ; 631.0bp to feature; MODIFIER silent_mutation Average:15.626; most accessible tissue: Callus, score: 20.564 N N N N
vg1204930683 A -> G LOC_Os12g09420.1 downstream_gene_variant ; 3118.0bp to feature; MODIFIER silent_mutation Average:15.626; most accessible tissue: Callus, score: 20.564 N N N N
vg1204930683 A -> G LOC_Os12g09400-LOC_Os12g09410 intergenic_region ; MODIFIER silent_mutation Average:15.626; most accessible tissue: Callus, score: 20.564 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204930683 NA 7.80E-06 mr1156 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204930683 NA 4.48E-06 mr1691 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204930683 NA 5.51E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204930683 NA 4.88E-06 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204930683 NA 3.55E-06 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251