\
| Variant ID: vg1204930683 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 4930683 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.66, A: 0.33, others allele: 0.00, population size: 80. )
GTGGCTGAGAGAAGAGACCCTTGAAAATGGCTCATTTTCATGATGTACTTCTCTTCTATTCTGCATGGTAGGATGGCTTATGCCTTAATGTGGTCCTAGT[A/G]
GCTTTTCTAAGCAGAGATGTTGACCTGCAGAACATCTCAGAAGGAACACACCTATATGAGTTCGACTGCTAGTCACAGTCTATGAGATTTGGACGATCTC
GAGATCGTCCAAATCTCATAGACTGTGACTAGCAGTCGAACTCATATAGGTGTGTTCCTTCTGAGATGTTCTGCAGGTCAACATCTCTGCTTAGAAAAGC[T/C]
ACTAGGACCACATTAAGGCATAAGCCATCCTACCATGCAGAATAGAAGAGAAGTACATCATGAAAATGAGCCATTTTCAAGGGTCTCTTCTCTCAGCCAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.30% | 16.40% | 15.04% | 29.28% | NA |
| All Indica | 2759 | 10.40% | 15.20% | 25.15% | 49.22% | NA |
| All Japonica | 1512 | 90.80% | 7.90% | 0.66% | 0.66% | NA |
| Aus | 269 | 13.80% | 85.90% | 0.00% | 0.37% | NA |
| Indica I | 595 | 15.10% | 11.30% | 26.39% | 47.23% | NA |
| Indica II | 465 | 8.80% | 13.80% | 27.10% | 50.32% | NA |
| Indica III | 913 | 6.20% | 15.80% | 25.41% | 52.57% | NA |
| Indica Intermediate | 786 | 12.70% | 18.30% | 22.77% | 46.18% | NA |
| Temperate Japonica | 767 | 95.70% | 3.50% | 0.13% | 0.65% | NA |
| Tropical Japonica | 504 | 94.00% | 3.40% | 1.59% | 0.99% | NA |
| Japonica Intermediate | 241 | 68.50% | 31.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 5.60% | 6.67% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1204930683 | A -> DEL | N | N | silent_mutation | Average:15.626; most accessible tissue: Callus, score: 20.564 | N | N | N | N |
| vg1204930683 | A -> G | LOC_Os12g09410.1 | upstream_gene_variant ; 1019.0bp to feature; MODIFIER | silent_mutation | Average:15.626; most accessible tissue: Callus, score: 20.564 | N | N | N | N |
| vg1204930683 | A -> G | LOC_Os12g09400.1 | downstream_gene_variant ; 631.0bp to feature; MODIFIER | silent_mutation | Average:15.626; most accessible tissue: Callus, score: 20.564 | N | N | N | N |
| vg1204930683 | A -> G | LOC_Os12g09420.1 | downstream_gene_variant ; 3118.0bp to feature; MODIFIER | silent_mutation | Average:15.626; most accessible tissue: Callus, score: 20.564 | N | N | N | N |
| vg1204930683 | A -> G | LOC_Os12g09400-LOC_Os12g09410 | intergenic_region ; MODIFIER | silent_mutation | Average:15.626; most accessible tissue: Callus, score: 20.564 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1204930683 | NA | 7.80E-06 | mr1156 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204930683 | NA | 4.48E-06 | mr1691 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204930683 | NA | 5.51E-07 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204930683 | NA | 4.88E-06 | mr1691_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204930683 | NA | 3.55E-06 | mr1720_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |