\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204824887:

Variant ID: vg1204824887 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4824887
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAATTAACTAGCAATAGTTTCTTATTTACTCGAGAAAAAAATGATTCAAAAGTCATCCCTTAAGAAAAAGTTTGTGAATGGTTTTTTAAGATACTTTGA[A/G]
AAAAATAGAACCCTTAAATTATTATAAAATAACATTATCCAACTTTAGTTTGCCCTTAATCTATGAGACAATTTTTGAACAAACAATAATTTTACCTTTC

Reverse complement sequence

GAAAGGTAAAATTATTGTTTGTTCAAAAATTGTCTCATAGATTAAGGGCAAACTAAAGTTGGATAATGTTATTTTATAATAATTTAAGGGTTCTATTTTT[T/C]
TCAAAGTATCTTAAAAAACCATTCACAAACTTTTTCTTAAGGGATGACTTTTGAATCATTTTTTTCTCGAGTAAATAAGAAACTATTGCTAGTTAATTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.50% 33.80% 0.21% 1.50% NA
All Indica  2759 96.50% 2.90% 0.11% 0.47% NA
All Japonica  1512 12.90% 86.90% 0.07% 0.13% NA
Aus  269 57.60% 21.20% 1.12% 20.07% NA
Indica I  595 97.60% 1.30% 0.17% 0.84% NA
Indica II  465 96.30% 3.20% 0.22% 0.22% NA
Indica III  913 97.80% 1.60% 0.00% 0.55% NA
Indica Intermediate  786 94.10% 5.50% 0.13% 0.25% NA
Temperate Japonica  767 5.10% 94.80% 0.00% 0.13% NA
Tropical Japonica  504 10.70% 89.30% 0.00% 0.00% NA
Japonica Intermediate  241 42.30% 56.80% 0.41% 0.41% NA
VI/Aromatic  96 6.20% 91.70% 2.08% 0.00% NA
Intermediate  90 34.40% 62.20% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204824887 A -> DEL N N silent_mutation Average:22.373; most accessible tissue: Minghui63 flower, score: 28.782 N N N N
vg1204824887 A -> G LOC_Os12g09220-LOC_Os12g09230 intergenic_region ; MODIFIER silent_mutation Average:22.373; most accessible tissue: Minghui63 flower, score: 28.782 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204824887 NA 9.34E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204824887 NA 1.58E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204824887 NA 3.39E-18 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204824887 NA 4.97E-07 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204824887 3.99E-06 NA mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204824887 1.77E-06 NA mr1679 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204824887 1.18E-06 NA mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204824887 2.31E-07 5.93E-09 mr1691 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204824887 4.52E-07 NA mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204824887 3.88E-09 2.49E-13 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204824887 7.77E-07 2.45E-08 mr1720 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204824887 NA 3.40E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204824887 NA 7.43E-06 mr1594_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204824887 8.15E-07 NA mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204824887 5.34E-06 2.76E-09 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204824887 NA 4.74E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204824887 NA 1.93E-08 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251