\
| Variant ID: vg1204824887 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 4824887 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATAATTAACTAGCAATAGTTTCTTATTTACTCGAGAAAAAAATGATTCAAAAGTCATCCCTTAAGAAAAAGTTTGTGAATGGTTTTTTAAGATACTTTGA[A/G]
AAAAATAGAACCCTTAAATTATTATAAAATAACATTATCCAACTTTAGTTTGCCCTTAATCTATGAGACAATTTTTGAACAAACAATAATTTTACCTTTC
GAAAGGTAAAATTATTGTTTGTTCAAAAATTGTCTCATAGATTAAGGGCAAACTAAAGTTGGATAATGTTATTTTATAATAATTTAAGGGTTCTATTTTT[T/C]
TCAAAGTATCTTAAAAAACCATTCACAAACTTTTTCTTAAGGGATGACTTTTGAATCATTTTTTTCTCGAGTAAATAAGAAACTATTGCTAGTTAATTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.50% | 33.80% | 0.21% | 1.50% | NA |
| All Indica | 2759 | 96.50% | 2.90% | 0.11% | 0.47% | NA |
| All Japonica | 1512 | 12.90% | 86.90% | 0.07% | 0.13% | NA |
| Aus | 269 | 57.60% | 21.20% | 1.12% | 20.07% | NA |
| Indica I | 595 | 97.60% | 1.30% | 0.17% | 0.84% | NA |
| Indica II | 465 | 96.30% | 3.20% | 0.22% | 0.22% | NA |
| Indica III | 913 | 97.80% | 1.60% | 0.00% | 0.55% | NA |
| Indica Intermediate | 786 | 94.10% | 5.50% | 0.13% | 0.25% | NA |
| Temperate Japonica | 767 | 5.10% | 94.80% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 10.70% | 89.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 42.30% | 56.80% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 6.20% | 91.70% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 34.40% | 62.20% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1204824887 | A -> DEL | N | N | silent_mutation | Average:22.373; most accessible tissue: Minghui63 flower, score: 28.782 | N | N | N | N |
| vg1204824887 | A -> G | LOC_Os12g09220-LOC_Os12g09230 | intergenic_region ; MODIFIER | silent_mutation | Average:22.373; most accessible tissue: Minghui63 flower, score: 28.782 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1204824887 | NA | 9.34E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204824887 | NA | 1.58E-06 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204824887 | NA | 3.39E-18 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204824887 | NA | 4.97E-07 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204824887 | 3.99E-06 | NA | mr1679 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204824887 | 1.77E-06 | NA | mr1679 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204824887 | 1.18E-06 | NA | mr1691 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204824887 | 2.31E-07 | 5.93E-09 | mr1691 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204824887 | 4.52E-07 | NA | mr1693 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204824887 | 3.88E-09 | 2.49E-13 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204824887 | 7.77E-07 | 2.45E-08 | mr1720 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204824887 | NA | 3.40E-06 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204824887 | NA | 7.43E-06 | mr1594_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204824887 | 8.15E-07 | NA | mr1679_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204824887 | 5.34E-06 | 2.76E-09 | mr1691_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204824887 | NA | 4.74E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204824887 | NA | 1.93E-08 | mr1720_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |