Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204807699:

Variant ID: vg1204807699 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 4807699
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGGCGCACGATGGGTTTGCTGAAGAACGCTACCGGCCCGCCACCTTGATGAAGCACCGCGCCAAACTCAGATCTTGATGCGTCACATTCGACGATGAAAT[T/C]
GGTGGTGAAGTCCGGCAACTGGAGCACCGGTGCGGCCGTCAGGGCGTGTTGCAGCTCGCTGAATGCCGTCGCCACCGCCTCATTCCAGTGAAAGCCCTCC

Reverse complement sequence

GGAGGGCTTTCACTGGAATGAGGCGGTGGCGACGGCATTCAGCGAGCTGCAACACGCCCTGACGGCCGCACCGGTGCTCCAGTTGCCGGACTTCACCACC[A/G]
ATTTCATCGTCGAATGTGACGCATCAAGATCTGAGTTTGGCGCGGTGCTTCATCAAGGTGGCGGGCCGGTAGCGTTCTTCAGCAAACCCATCGTGCGCCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.20%	33.70%	0.04%	0.00%	NA
All Indica	2759	97.20%	2.80%	0.04%	0.00%	NA
All Japonica	1512	13.10%	86.90%	0.00%	0.00%	NA
Aus	269	79.60%	20.10%	0.37%	0.00%	NA
Indica I	595	99.00%	1.00%	0.00%	0.00%	NA
Indica II	465	96.30%	3.70%	0.00%	0.00%	NA
Indica III	913	98.10%	1.80%	0.11%	0.00%	NA
Indica Intermediate	786	95.30%	4.70%	0.00%	0.00%	NA
Temperate Japonica	767	5.10%	94.90%	0.00%	0.00%	NA
Tropical Japonica	504	10.90%	89.10%	0.00%	0.00%	NA
Japonica Intermediate	241	43.20%	56.80%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	36.70%	63.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1204807699	T -> C	LOC_Os12g09210.1	3_prime_UTR_variant ; 997.0bp to feature; MODIFIER	silent_mutation	Average:71.268; most accessible tissue: Zhenshan97 young leaf, score: 87.584	N	N	N	N
vg1204807699	T -> C	LOC_Os12g09200.1	downstream_gene_variant ; 2810.0bp to feature; MODIFIER	silent_mutation	Average:71.268; most accessible tissue: Zhenshan97 young leaf, score: 87.584	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1204807699	NA	1.10E-14	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204807699	NA	3.36E-18	mr1242	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204807699	NA	5.84E-06	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204807699	NA	2.48E-07	mr1691	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204807699	NA	2.01E-11	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204807699	NA	5.78E-06	mr1720	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204807699	NA	6.43E-06	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204807699	NA	7.50E-13	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204807699	NA	8.52E-07	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204807699	6.30E-08	NA	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204807699	3.55E-06	1.19E-07	mr1679_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204807699	3.86E-07	NA	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204807699	1.67E-07	2.00E-11	mr1691_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204807699	2.29E-07	NA	mr1720_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204807699	4.19E-08	2.24E-11	mr1720_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251