\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204785320:

Variant ID: vg1204785320 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4785320
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCATCCTCGGCAAGCATCCTAGACTTGTTACTCTTGGAGGTTGCCGCCTCCTAGACGGCTTGTGGAGGTGTAGACCGGTGACCTCTCCGAGGAGATTGT[G/T]
GAGGAGGCCCGGCGCTGGTTGTGAGTGGTTTGGAGTTCACCACCTTCGGAGTGAAGGAAGAACTACCCTAGTGATCGAGGCTTGGGTAGTCCTCTCCGTG

Reverse complement sequence

CACGGAGAGGACTACCCAAGCCTCGATCACTAGGGTAGTTCTTCCTTCACTCCGAAGGTGGTGAACTCCAAACCACTCACAACCAGCGCCGGGCCTCCTC[C/A]
ACAATCTCCTCGGAGAGGTCACCGGTCTACACCTCCACAAGCCGTCTAGGAGGCGGCAACCTCCAAGAGTAACAAGTCTAGGATGCTTGCCGAGGATGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.20% 7.20% 0.59% 0.00% NA
All Indica  2759 99.70% 0.20% 0.04% 0.00% NA
All Japonica  1512 76.50% 21.80% 1.72% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.40% 0.40% 0.22% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 95.20% 3.90% 0.91% 0.00% NA
Tropical Japonica  504 42.50% 54.80% 2.78% 0.00% NA
Japonica Intermediate  241 88.00% 10.00% 2.07% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204785320 G -> T LOC_Os12g09150.1 upstream_gene_variant ; 2312.0bp to feature; MODIFIER silent_mutation Average:59.551; most accessible tissue: Minghui63 flag leaf, score: 81.052 N N N N
vg1204785320 G -> T LOC_Os12g09140.1 downstream_gene_variant ; 2395.0bp to feature; MODIFIER silent_mutation Average:59.551; most accessible tissue: Minghui63 flag leaf, score: 81.052 N N N N
vg1204785320 G -> T LOC_Os12g09140-LOC_Os12g09150 intergenic_region ; MODIFIER silent_mutation Average:59.551; most accessible tissue: Minghui63 flag leaf, score: 81.052 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204785320 NA 7.71E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204785320 NA 1.21E-13 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204785320 NA 3.24E-07 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204785320 3.06E-06 NA mr1136_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204785320 NA 7.00E-13 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204785320 NA 2.74E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204785320 NA 6.28E-09 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251