\
| Variant ID: vg1204785320 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 4785320 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATCATCCTCGGCAAGCATCCTAGACTTGTTACTCTTGGAGGTTGCCGCCTCCTAGACGGCTTGTGGAGGTGTAGACCGGTGACCTCTCCGAGGAGATTGT[G/T]
GAGGAGGCCCGGCGCTGGTTGTGAGTGGTTTGGAGTTCACCACCTTCGGAGTGAAGGAAGAACTACCCTAGTGATCGAGGCTTGGGTAGTCCTCTCCGTG
CACGGAGAGGACTACCCAAGCCTCGATCACTAGGGTAGTTCTTCCTTCACTCCGAAGGTGGTGAACTCCAAACCACTCACAACCAGCGCCGGGCCTCCTC[C/A]
ACAATCTCCTCGGAGAGGTCACCGGTCTACACCTCCACAAGCCGTCTAGGAGGCGGCAACCTCCAAGAGTAACAAGTCTAGGATGCTTGCCGAGGATGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.20% | 7.20% | 0.59% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 76.50% | 21.80% | 1.72% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 95.20% | 3.90% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 42.50% | 54.80% | 2.78% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.00% | 10.00% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 5.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1204785320 | G -> T | LOC_Os12g09150.1 | upstream_gene_variant ; 2312.0bp to feature; MODIFIER | silent_mutation | Average:59.551; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg1204785320 | G -> T | LOC_Os12g09140.1 | downstream_gene_variant ; 2395.0bp to feature; MODIFIER | silent_mutation | Average:59.551; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg1204785320 | G -> T | LOC_Os12g09140-LOC_Os12g09150 | intergenic_region ; MODIFIER | silent_mutation | Average:59.551; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1204785320 | NA | 7.71E-06 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204785320 | NA | 1.21E-13 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204785320 | NA | 3.24E-07 | mr1039_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204785320 | 3.06E-06 | NA | mr1136_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204785320 | NA | 7.00E-13 | mr1178_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204785320 | NA | 2.74E-08 | mr1261_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204785320 | NA | 6.28E-09 | mr1632_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |