Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204785320:

Variant ID: vg1204785320 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 4785320
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCATCCTCGGCAAGCATCCTAGACTTGTTACTCTTGGAGGTTGCCGCCTCCTAGACGGCTTGTGGAGGTGTAGACCGGTGACCTCTCCGAGGAGATTGT[G/T]
GAGGAGGCCCGGCGCTGGTTGTGAGTGGTTTGGAGTTCACCACCTTCGGAGTGAAGGAAGAACTACCCTAGTGATCGAGGCTTGGGTAGTCCTCTCCGTG

Reverse complement sequence

CACGGAGAGGACTACCCAAGCCTCGATCACTAGGGTAGTTCTTCCTTCACTCCGAAGGTGGTGAACTCCAAACCACTCACAACCAGCGCCGGGCCTCCTC[C/A]
ACAATCTCCTCGGAGAGGTCACCGGTCTACACCTCCACAAGCCGTCTAGGAGGCGGCAACCTCCAAGAGTAACAAGTCTAGGATGCTTGCCGAGGATGAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.20%	7.20%	0.59%	0.00%	NA
All Indica	2759	99.70%	0.20%	0.04%	0.00%	NA
All Japonica	1512	76.50%	21.80%	1.72%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.40%	0.40%	0.22%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	95.20%	3.90%	0.91%	0.00%	NA
Tropical Japonica	504	42.50%	54.80%	2.78%	0.00%	NA
Japonica Intermediate	241	88.00%	10.00%	2.07%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	5.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1204785320	G -> T	LOC_Os12g09150.1	upstream_gene_variant ; 2312.0bp to feature; MODIFIER	silent_mutation	Average:59.551; most accessible tissue: Minghui63 flag leaf, score: 81.052	N	N	N	N
vg1204785320	G -> T	LOC_Os12g09140.1	downstream_gene_variant ; 2395.0bp to feature; MODIFIER	silent_mutation	Average:59.551; most accessible tissue: Minghui63 flag leaf, score: 81.052	N	N	N	N
vg1204785320	G -> T	LOC_Os12g09140-LOC_Os12g09150	intergenic_region ; MODIFIER	silent_mutation	Average:59.551; most accessible tissue: Minghui63 flag leaf, score: 81.052	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1204785320	NA	7.71E-06	mr1425	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204785320	NA	1.21E-13	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204785320	NA	3.24E-07	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204785320	3.06E-06	NA	mr1136_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204785320	NA	7.00E-13	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204785320	NA	2.74E-08	mr1261_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204785320	NA	6.28E-09	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251