\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204727738:

Variant ID: vg1204727738 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4727738
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATCGCTATCGGTTGGTATCGGCATCGGCTGGAACTACTACATCGGCTTGTCAGCCGATCGGCTGATTTATCTACTGTTTACATATCTTGTCAGTTGTAG[G/A]
ATCAAACTGACTGGCATGCCCGCATCTCATCAATCTTTGGACTTGCACAGGAGCTAAGCAGATCTCCCAGGCCAGTGTGTTCGATTTTTTCATCAACACT

Reverse complement sequence

AGTGTTGATGAAAAAATCGAACACACTGGCCTGGGAGATCTGCTTAGCTCCTGTGCAAGTCCAAAGATTGATGAGATGCGGGCATGCCAGTCAGTTTGAT[C/T]
CTACAACTGACAAGATATGTAAACAGTAGATAAATCAGCCGATCGGCTGACAAGCCGATGTAGTAGTTCCAGCCGATGCCGATACCAACCGATAGCGATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.70% 41.00% 0.00% 0.32% NA
All Indica  2759 96.10% 3.60% 0.00% 0.29% NA
All Japonica  1512 0.90% 98.90% 0.00% 0.20% NA
Aus  269 29.70% 70.30% 0.00% 0.00% NA
Indica I  595 98.00% 1.80% 0.00% 0.17% NA
Indica II  465 96.10% 3.70% 0.00% 0.22% NA
Indica III  913 97.40% 2.30% 0.00% 0.33% NA
Indica Intermediate  786 93.30% 6.40% 0.00% 0.38% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.00% 0.00% 0.20% NA
Japonica Intermediate  241 0.80% 98.30% 0.00% 0.83% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 31.10% 64.40% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204727738 G -> DEL N N silent_mutation Average:39.227; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg1204727738 G -> A LOC_Os12g09050.1 upstream_gene_variant ; 1731.0bp to feature; MODIFIER silent_mutation Average:39.227; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg1204727738 G -> A LOC_Os12g09060.1 downstream_gene_variant ; 4276.0bp to feature; MODIFIER silent_mutation Average:39.227; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg1204727738 G -> A LOC_Os12g09030-LOC_Os12g09050 intergenic_region ; MODIFIER silent_mutation Average:39.227; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204727738 NA 5.68E-23 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204727738 NA 2.99E-18 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204727738 NA 1.10E-13 mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204727738 NA 2.90E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204727738 NA 1.87E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204727738 NA 2.50E-12 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204727738 NA 2.21E-21 mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204727738 2.34E-06 NA mr1553_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204727738 NA 1.45E-16 mr1744_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204727738 NA 8.85E-22 mr1971_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251