Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1204727738:

Variant ID: vg1204727738 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 4727738
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATCGCTATCGGTTGGTATCGGCATCGGCTGGAACTACTACATCGGCTTGTCAGCCGATCGGCTGATTTATCTACTGTTTACATATCTTGTCAGTTGTAG[G/A]
ATCAAACTGACTGGCATGCCCGCATCTCATCAATCTTTGGACTTGCACAGGAGCTAAGCAGATCTCCCAGGCCAGTGTGTTCGATTTTTTCATCAACACT

Reverse complement sequence

AGTGTTGATGAAAAAATCGAACACACTGGCCTGGGAGATCTGCTTAGCTCCTGTGCAAGTCCAAAGATTGATGAGATGCGGGCATGCCAGTCAGTTTGAT[C/T]
CTACAACTGACAAGATATGTAAACAGTAGATAAATCAGCCGATCGGCTGACAAGCCGATGTAGTAGTTCCAGCCGATGCCGATACCAACCGATAGCGATA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.70%	41.00%	0.00%	0.32%	NA
All Indica	2759	96.10%	3.60%	0.00%	0.29%	NA
All Japonica	1512	0.90%	98.90%	0.00%	0.20%	NA
Aus	269	29.70%	70.30%	0.00%	0.00%	NA
Indica I	595	98.00%	1.80%	0.00%	0.17%	NA
Indica II	465	96.10%	3.70%	0.00%	0.22%	NA
Indica III	913	97.40%	2.30%	0.00%	0.33%	NA
Indica Intermediate	786	93.30%	6.40%	0.00%	0.38%	NA
Temperate Japonica	767	0.90%	99.10%	0.00%	0.00%	NA
Tropical Japonica	504	0.80%	99.00%	0.00%	0.20%	NA
Japonica Intermediate	241	0.80%	98.30%	0.00%	0.83%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	31.10%	64.40%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1204727738	G -> DEL	N	N	silent_mutation	Average:39.227; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg1204727738	G -> A	LOC_Os12g09050.1	upstream_gene_variant ; 1731.0bp to feature; MODIFIER	silent_mutation	Average:39.227; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg1204727738	G -> A	LOC_Os12g09060.1	downstream_gene_variant ; 4276.0bp to feature; MODIFIER	silent_mutation	Average:39.227; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg1204727738	G -> A	LOC_Os12g09030-LOC_Os12g09050	intergenic_region ; MODIFIER	silent_mutation	Average:39.227; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1204727738	NA	5.68E-23	mr1020	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204727738	NA	2.99E-18	mr1179	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204727738	NA	1.10E-13	mr1362	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204727738	NA	2.90E-12	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204727738	NA	1.87E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204727738	NA	2.50E-12	mr1938	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204727738	NA	2.21E-21	mr1971	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204727738	2.34E-06	NA	mr1553_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204727738	NA	1.45E-16	mr1744_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204727738	NA	8.85E-22	mr1971_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251