\
| Variant ID: vg1204727738 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 4727738 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TATCGCTATCGGTTGGTATCGGCATCGGCTGGAACTACTACATCGGCTTGTCAGCCGATCGGCTGATTTATCTACTGTTTACATATCTTGTCAGTTGTAG[G/A]
ATCAAACTGACTGGCATGCCCGCATCTCATCAATCTTTGGACTTGCACAGGAGCTAAGCAGATCTCCCAGGCCAGTGTGTTCGATTTTTTCATCAACACT
AGTGTTGATGAAAAAATCGAACACACTGGCCTGGGAGATCTGCTTAGCTCCTGTGCAAGTCCAAAGATTGATGAGATGCGGGCATGCCAGTCAGTTTGAT[C/T]
CTACAACTGACAAGATATGTAAACAGTAGATAAATCAGCCGATCGGCTGACAAGCCGATGTAGTAGTTCCAGCCGATGCCGATACCAACCGATAGCGATA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.70% | 41.00% | 0.00% | 0.32% | NA |
| All Indica | 2759 | 96.10% | 3.60% | 0.00% | 0.29% | NA |
| All Japonica | 1512 | 0.90% | 98.90% | 0.00% | 0.20% | NA |
| Aus | 269 | 29.70% | 70.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.00% | 1.80% | 0.00% | 0.17% | NA |
| Indica II | 465 | 96.10% | 3.70% | 0.00% | 0.22% | NA |
| Indica III | 913 | 97.40% | 2.30% | 0.00% | 0.33% | NA |
| Indica Intermediate | 786 | 93.30% | 6.40% | 0.00% | 0.38% | NA |
| Temperate Japonica | 767 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.80% | 99.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 0.80% | 98.30% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 31.10% | 64.40% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1204727738 | G -> DEL | N | N | silent_mutation | Average:39.227; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg1204727738 | G -> A | LOC_Os12g09050.1 | upstream_gene_variant ; 1731.0bp to feature; MODIFIER | silent_mutation | Average:39.227; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg1204727738 | G -> A | LOC_Os12g09060.1 | downstream_gene_variant ; 4276.0bp to feature; MODIFIER | silent_mutation | Average:39.227; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg1204727738 | G -> A | LOC_Os12g09030-LOC_Os12g09050 | intergenic_region ; MODIFIER | silent_mutation | Average:39.227; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1204727738 | NA | 5.68E-23 | mr1020 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204727738 | NA | 2.99E-18 | mr1179 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204727738 | NA | 1.10E-13 | mr1362 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204727738 | NA | 2.90E-12 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204727738 | NA | 1.87E-07 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204727738 | NA | 2.50E-12 | mr1938 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204727738 | NA | 2.21E-21 | mr1971 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204727738 | 2.34E-06 | NA | mr1553_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204727738 | NA | 1.45E-16 | mr1744_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204727738 | NA | 8.85E-22 | mr1971_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |