Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204623591:

Variant ID: vg1204623591 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 4623591
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.81, A: 0.19, others allele: 0.00, population size: 57. )

Flanking Sequence (100 bp) in Reference Genome:

CAATGTAACAAACAGAACCAACGTGGGTGCAGTCCCTTCAAGTCCCCCCTATACCCACGAGACCTATAGATATTCCTGGAACACTCTTTCGATTTTTTCA[A/T]
CATGAATAATAAACTAAAGATTTCTAAATGGTTGGAGATTAAAGAAACTGTGTAATTGAGCCCCCTAATTTTTTGTTCCTGGATCCGCCCCTAGCAACAA

Reverse complement sequence

TTGTTGCTAGGGGCGGATCCAGGAACAAAAAATTAGGGGGCTCAATTACACAGTTTCTTTAATCTCCAACCATTTAGAAATCTTTAGTTTATTATTCATG[T/A]
TGAAAAAATCGAAAGAGTGTTCCAGGAATATCTATAGGTCTCGTGGGTATAGGGGGGACTTGAAGGGACTGCACCCACGTTGGTTCTGTTTGTTACATTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.10%	10.30%	0.61%	53.05%	NA
All Indica	2759	4.10%	5.40%	0.94%	89.53%	NA
All Japonica	1512	87.60%	11.50%	0.20%	0.73%	NA
Aus	269	42.00%	57.20%	0.00%	0.74%	NA
Indica I	595	2.70%	11.90%	0.67%	84.71%	NA
Indica II	465	5.60%	0.60%	1.08%	92.69%	NA
Indica III	913	2.50%	1.90%	0.55%	95.07%	NA
Indica Intermediate	786	6.20%	7.40%	1.53%	84.86%	NA
Temperate Japonica	767	95.00%	3.80%	0.39%	0.78%	NA
Tropical Japonica	504	91.30%	7.90%	0.00%	0.79%	NA
Japonica Intermediate	241	56.00%	43.60%	0.00%	0.41%	NA
VI/Aromatic	96	95.80%	3.10%	0.00%	1.04%	NA
Intermediate	90	67.80%	6.70%	0.00%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1204623591	A -> DEL	N	N	silent_mutation	Average:10.85; most accessible tissue: Callus, score: 61.594	N	N	N	N
vg1204623591	A -> T	LOC_Os12g08890-LOC_Os12g08900	intergenic_region ; MODIFIER	silent_mutation	Average:10.85; most accessible tissue: Callus, score: 61.594	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1204623591	NA	6.18E-06	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623591	NA	5.33E-07	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623591	NA	4.02E-06	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623591	NA	1.38E-07	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623591	NA	4.43E-08	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623591	NA	4.63E-06	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623591	NA	4.27E-06	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623591	4.62E-08	NA	mr1679	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623591	1.41E-06	1.94E-09	mr1679	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623591	2.10E-06	NA	mr1691	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623591	1.50E-08	1.05E-10	mr1691	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623591	2.23E-08	NA	mr1693	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623591	7.76E-10	3.65E-15	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623591	7.75E-07	1.26E-08	mr1720	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623591	NA	6.55E-06	mr1114_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623591	NA	2.11E-07	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623591	NA	1.31E-06	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623591	NA	7.53E-06	mr1120_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623591	NA	2.64E-06	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623591	NA	1.84E-06	mr1242_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623591	NA	6.57E-06	mr1247_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623591	NA	8.49E-08	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623591	NA	2.78E-06	mr1594_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623591	4.32E-06	1.11E-07	mr1679_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623591	8.96E-06	1.17E-06	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623591	1.94E-07	5.70E-11	mr1691_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623591	3.83E-06	NA	mr1720_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623591	8.86E-06	1.37E-08	mr1720_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251