Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204623507:

Variant ID: vg1204623507 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 4623507
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.84, A: 0.16, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:

TTCGCACATCAAATTCGGGGGATGTACAGGCTAGGGTCTGCATGCATGCTGGTATCTACAGAATCTTCTTCGTAGTGAGCATGGCAATGTAACAAACAGA[A/T]
CCAACGTGGGTGCAGTCCCTTCAAGTCCCCCCTATACCCACGAGACCTATAGATATTCCTGGAACACTCTTTCGATTTTTTCAACATGAATAATAAACTA

Reverse complement sequence

TAGTTTATTATTCATGTTGAAAAAATCGAAAGAGTGTTCCAGGAATATCTATAGGTCTCGTGGGTATAGGGGGGACTTGAAGGGACTGCACCCACGTTGG[T/A]
TCTGTTTGTTACATTGCCATGCTCACTACGAAGAAGATTCTGTAGATACCAGCATGCATGCAGACCCTAGCCTGTACATCCCCCGAATTTGATGTGCGAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.20%	10.20%	0.99%	52.60%	NA
All Indica	2759	4.30%	5.40%	1.45%	88.84%	NA
All Japonica	1512	87.60%	11.50%	0.20%	0.66%	NA
Aus	269	42.40%	56.50%	0.37%	0.74%	NA
Indica I	595	2.70%	11.80%	1.18%	84.37%	NA
Indica II	465	5.60%	0.60%	2.15%	91.61%	NA
Indica III	913	2.30%	2.00%	1.42%	94.30%	NA
Indica Intermediate	786	7.30%	7.30%	1.27%	84.22%	NA
Temperate Japonica	767	95.20%	3.80%	0.39%	0.65%	NA
Tropical Japonica	504	91.30%	7.90%	0.00%	0.79%	NA
Japonica Intermediate	241	56.00%	43.60%	0.00%	0.41%	NA
VI/Aromatic	96	95.80%	3.10%	1.04%	0.00%	NA
Intermediate	90	65.60%	6.70%	2.22%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1204623507	A -> DEL	N	N	silent_mutation	Average:13.945; most accessible tissue: Callus, score: 90.775	N	N	N	N
vg1204623507	A -> T	LOC_Os12g08890-LOC_Os12g08900	intergenic_region ; MODIFIER	silent_mutation	Average:13.945; most accessible tissue: Callus, score: 90.775	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1204623507	NA	6.18E-06	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	NA	5.33E-07	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	NA	4.02E-06	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	NA	1.38E-07	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	NA	4.43E-08	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	NA	4.63E-06	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	NA	4.27E-06	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	4.89E-09	NA	mr1679	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	1.41E-06	1.94E-09	mr1679	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	6.07E-06	NA	mr1691	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	1.50E-08	1.05E-10	mr1691	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	1.11E-08	5.50E-10	mr1693	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	7.76E-10	3.65E-15	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	7.75E-07	1.26E-08	mr1720	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	NA	6.55E-06	mr1114_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	NA	2.11E-07	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	NA	1.31E-06	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	NA	7.53E-06	mr1120_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	NA	2.64E-06	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	7.13E-06	NA	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	NA	1.84E-06	mr1242_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	NA	6.57E-06	mr1247_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	NA	8.49E-08	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	NA	2.78E-06	mr1594_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	1.45E-06	NA	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	4.32E-06	1.11E-07	mr1679_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	NA	7.37E-07	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	1.94E-07	5.70E-11	mr1691_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	7.97E-07	NA	mr1720_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507	8.86E-06	1.37E-08	mr1720_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251