\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204623507:

Variant ID: vg1204623507 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4623507
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.84, A: 0.16, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


TTCGCACATCAAATTCGGGGGATGTACAGGCTAGGGTCTGCATGCATGCTGGTATCTACAGAATCTTCTTCGTAGTGAGCATGGCAATGTAACAAACAGA[A/T]
CCAACGTGGGTGCAGTCCCTTCAAGTCCCCCCTATACCCACGAGACCTATAGATATTCCTGGAACACTCTTTCGATTTTTTCAACATGAATAATAAACTA

Reverse complement sequence

TAGTTTATTATTCATGTTGAAAAAATCGAAAGAGTGTTCCAGGAATATCTATAGGTCTCGTGGGTATAGGGGGGACTTGAAGGGACTGCACCCACGTTGG[T/A]
TCTGTTTGTTACATTGCCATGCTCACTACGAAGAAGATTCTGTAGATACCAGCATGCATGCAGACCCTAGCCTGTACATCCCCCGAATTTGATGTGCGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.20% 10.20% 0.99% 52.60% NA
All Indica  2759 4.30% 5.40% 1.45% 88.84% NA
All Japonica  1512 87.60% 11.50% 0.20% 0.66% NA
Aus  269 42.40% 56.50% 0.37% 0.74% NA
Indica I  595 2.70% 11.80% 1.18% 84.37% NA
Indica II  465 5.60% 0.60% 2.15% 91.61% NA
Indica III  913 2.30% 2.00% 1.42% 94.30% NA
Indica Intermediate  786 7.30% 7.30% 1.27% 84.22% NA
Temperate Japonica  767 95.20% 3.80% 0.39% 0.65% NA
Tropical Japonica  504 91.30% 7.90% 0.00% 0.79% NA
Japonica Intermediate  241 56.00% 43.60% 0.00% 0.41% NA
VI/Aromatic  96 95.80% 3.10% 1.04% 0.00% NA
Intermediate  90 65.60% 6.70% 2.22% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204623507 A -> DEL N N silent_mutation Average:13.945; most accessible tissue: Callus, score: 90.775 N N N N
vg1204623507 A -> T LOC_Os12g08890-LOC_Os12g08900 intergenic_region ; MODIFIER silent_mutation Average:13.945; most accessible tissue: Callus, score: 90.775 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204623507 NA 6.18E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 NA 5.33E-07 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 NA 4.02E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 NA 1.38E-07 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 NA 4.43E-08 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 NA 4.63E-06 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 NA 4.27E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 4.89E-09 NA mr1679 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 1.41E-06 1.94E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 6.07E-06 NA mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 1.50E-08 1.05E-10 mr1691 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 1.11E-08 5.50E-10 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 7.76E-10 3.65E-15 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 7.75E-07 1.26E-08 mr1720 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 NA 6.55E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 NA 2.11E-07 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 NA 1.31E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 NA 7.53E-06 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 NA 2.64E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 7.13E-06 NA mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 NA 1.84E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 NA 6.57E-06 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 NA 8.49E-08 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 NA 2.78E-06 mr1594_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 1.45E-06 NA mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 4.32E-06 1.11E-07 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 NA 7.37E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 1.94E-07 5.70E-11 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 7.97E-07 NA mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204623507 8.86E-06 1.37E-08 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251