\
| Variant ID: vg1204623407 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 4623407 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, G: 0.18, others allele: 0.00, population size: 94. )
AACGAAAAGGTAATAATTTCCTGGGTGTGAGCCGACGCGGCAAGACGAATCTGAACCTTCTCACCTTGCACCGATATATGGATCCTTCCCCTATCCAGGC[T/G]
TCGCACATCAAATTCGGGGGATGTACAGGCTAGGGTCTGCATGCATGCTGGTATCTACAGAATCTTCTTCGTAGTGAGCATGGCAATGTAACAAACAGAA
TTCTGTTTGTTACATTGCCATGCTCACTACGAAGAAGATTCTGTAGATACCAGCATGCATGCAGACCCTAGCCTGTACATCCCCCGAATTTGATGTGCGA[A/C]
GCCTGGATAGGGGAAGGATCCATATATCGGTGCAAGGTGAGAAGGTTCAGATTCGTCTTGCCGCGTCGGCTCACACCCAGGAAATTATTACCTTTTCGTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.20% | 10.40% | 0.85% | 52.60% | NA |
| All Indica | 2759 | 4.50% | 5.40% | 1.38% | 88.76% | NA |
| All Japonica | 1512 | 87.50% | 11.80% | 0.07% | 0.66% | NA |
| Aus | 269 | 42.40% | 56.90% | 0.00% | 0.74% | NA |
| Indica I | 595 | 2.90% | 11.80% | 0.84% | 84.54% | NA |
| Indica II | 465 | 6.20% | 0.60% | 1.51% | 91.61% | NA |
| Indica III | 913 | 2.70% | 2.00% | 1.31% | 93.98% | NA |
| Indica Intermediate | 786 | 6.60% | 7.40% | 1.78% | 84.22% | NA |
| Temperate Japonica | 767 | 95.00% | 4.20% | 0.13% | 0.65% | NA |
| Tropical Japonica | 504 | 91.30% | 7.90% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 55.60% | 44.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 93.80% | 4.20% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 65.60% | 7.80% | 0.00% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1204623407 | T -> DEL | N | N | silent_mutation | Average:13.057; most accessible tissue: Callus, score: 83.017 | N | N | N | N |
| vg1204623407 | T -> G | LOC_Os12g08890-LOC_Os12g08900 | intergenic_region ; MODIFIER | silent_mutation | Average:13.057; most accessible tissue: Callus, score: 83.017 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1204623407 | NA | 3.24E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204623407 | NA | 1.23E-06 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204623407 | NA | 5.29E-07 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204623407 | 5.26E-07 | NA | mr1679 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204623407 | NA | 8.28E-09 | mr1679 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204623407 | 5.34E-07 | 8.38E-10 | mr1691 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204623407 | 1.21E-07 | 4.69E-14 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204623407 | 6.55E-06 | 3.69E-08 | mr1720 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204623407 | NA | 2.25E-06 | mr1042_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204623407 | NA | 1.45E-06 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204623407 | NA | 5.93E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204623407 | NA | 5.81E-06 | mr1123_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204623407 | NA | 4.08E-07 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204623407 | NA | 1.54E-06 | mr1594_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204623407 | NA | 5.66E-07 | mr1679_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204623407 | 6.59E-06 | 1.18E-09 | mr1691_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204623407 | NA | 5.73E-08 | mr1720_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |