\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204622168:

Variant ID: vg1204622168 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4622168
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGGTTTGCATAATCTCTTATTGCTTTGAATTGTTTCTTTTTCCATTTGGCAAGCTTATGGGTATGTACAACATTTTTATTTTTACTAGAAAAAAATGCC[C/T]
GTGCGTTGCAACGGGTAAAAATATTTTGAAATTGATATACATTATCTAGCTTGCTTGGTTTTTTTAGTTGAATACTCCTTGGTTTTAGGCTGAAAGTCCC

Reverse complement sequence

GGGACTTTCAGCCTAAAACCAAGGAGTATTCAACTAAAAAAACCAAGCAAGCTAGATAATGTATATCAATTTCAAAATATTTTTACCCGTTGCAACGCAC[G/A]
GGCATTTTTTTCTAGTAAAAATAAAAATGTTGTACATACCCATAAGCTTGCCAAATGGAAAAAGAAACAATTCAAAGCAATAAGAGATTATGCAAACCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.00% 8.80% 14.90% 18.28% NA
All Indica  2759 41.00% 4.60% 24.07% 30.37% NA
All Japonica  1512 88.10% 11.40% 0.26% 0.26% NA
Aus  269 44.20% 41.60% 10.41% 3.72% NA
Indica I  595 13.40% 10.60% 35.29% 40.67% NA
Indica II  465 45.20% 0.60% 25.38% 28.82% NA
Indica III  913 59.70% 1.40% 12.60% 26.29% NA
Indica Intermediate  786 37.70% 6.00% 28.12% 28.24% NA
Temperate Japonica  767 96.00% 3.50% 0.13% 0.39% NA
Tropical Japonica  504 91.70% 7.90% 0.20% 0.20% NA
Japonica Intermediate  241 55.60% 43.60% 0.83% 0.00% NA
VI/Aromatic  96 95.80% 2.10% 1.04% 1.04% NA
Intermediate  90 76.70% 3.30% 7.78% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204622168 C -> DEL N N silent_mutation Average:19.694; most accessible tissue: Callus, score: 39.823 N N N N
vg1204622168 C -> T LOC_Os12g08890.1 upstream_gene_variant ; 4862.0bp to feature; MODIFIER silent_mutation Average:19.694; most accessible tissue: Callus, score: 39.823 N N N N
vg1204622168 C -> T LOC_Os12g08890-LOC_Os12g08900 intergenic_region ; MODIFIER silent_mutation Average:19.694; most accessible tissue: Callus, score: 39.823 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204622168 NA 3.16E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204622168 NA 1.54E-07 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204622168 NA 3.48E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204622168 NA 6.30E-06 mr1120 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204622168 NA 3.54E-08 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204622168 NA 2.16E-07 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204622168 NA 3.09E-07 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204622168 NA 1.60E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204622168 2.63E-07 NA mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204622168 1.02E-07 5.58E-11 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204622168 1.28E-06 NA mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204622168 2.20E-10 3.00E-13 mr1691 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204622168 1.35E-08 1.89E-09 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204622168 7.80E-13 3.33E-19 mr1693 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204622168 1.14E-08 5.52E-11 mr1720 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204622168 NA 4.42E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204622168 NA 6.00E-08 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204622168 NA 5.08E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204622168 NA 1.62E-07 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204622168 NA 1.41E-06 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204622168 NA 5.32E-07 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204622168 NA 4.82E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204622168 NA 4.41E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204622168 NA 1.76E-06 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204622168 NA 1.45E-08 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204622168 3.51E-06 6.44E-08 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204622168 5.83E-07 3.01E-10 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204622168 7.85E-06 1.61E-08 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251