\
| Variant ID: vg1204614271 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 4614271 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GAGAAGAGAAAATACAAAGGAGAAGTGGGAAAAAATCCAGAAGGATTGATGGGGCTTAAAAGAATTTTACTAAGGAGTGAAATATCATGTATATATCAAT[G/C]
GAGCCCGGTTAAACTGTAATTTTTATCAACAAATATATTATTTCCAACATATATACTTATATTAAATCCTTTAGCTCATAAAAACATTTTATACATTTGC
GCAAATGTATAAAATGTTTTTATGAGCTAAAGGATTTAATATAAGTATATATGTTGGAAATAATATATTTGTTGATAAAAATTACAGTTTAACCGGGCTC[C/G]
ATTGATATATACATGATATTTCACTCCTTAGTAAAATTCTTTTAAGCCCCATCAATCCTTCTGGATTTTTTCCCACTTCTCCTTTGTATTTTCTCTTCTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.40% | 2.20% | 0.38% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 92.90% | 6.00% | 1.06% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 80.80% | 17.10% | 2.18% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.30% | 2.10% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 6.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1204614271 | G -> C | LOC_Os12g08890.1 | downstream_gene_variant ; 1962.0bp to feature; MODIFIER | silent_mutation | Average:35.177; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg1204614271 | G -> C | LOC_Os12g08880-LOC_Os12g08890 | intergenic_region ; MODIFIER | silent_mutation | Average:35.177; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1204614271 | NA | 9.07E-09 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204614271 | NA | 9.20E-07 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204614271 | NA | 1.78E-06 | mr1218_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204614271 | NA | 1.60E-07 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204614271 | NA | 1.17E-07 | mr1583_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204614271 | 5.47E-08 | 1.78E-14 | mr1850_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |