\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204614271:

Variant ID: vg1204614271 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4614271
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGAAGAGAAAATACAAAGGAGAAGTGGGAAAAAATCCAGAAGGATTGATGGGGCTTAAAAGAATTTTACTAAGGAGTGAAATATCATGTATATATCAAT[G/C]
GAGCCCGGTTAAACTGTAATTTTTATCAACAAATATATTATTTCCAACATATATACTTATATTAAATCCTTTAGCTCATAAAAACATTTTATACATTTGC

Reverse complement sequence

GCAAATGTATAAAATGTTTTTATGAGCTAAAGGATTTAATATAAGTATATATGTTGGAAATAATATATTTGTTGATAAAAATTACAGTTTAACCGGGCTC[C/G]
ATTGATATATACATGATATTTCACTCCTTAGTAAAATTCTTTTAAGCCCCATCAATCCTTCTGGATTTTTTCCCACTTCTCCTTTGTATTTTCTCTTCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.40% 2.20% 0.38% 0.00% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 92.90% 6.00% 1.06% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 80.80% 17.10% 2.18% 0.00% NA
Japonica Intermediate  241 96.30% 2.10% 1.66% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 6.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204614271 G -> C LOC_Os12g08890.1 downstream_gene_variant ; 1962.0bp to feature; MODIFIER silent_mutation Average:35.177; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg1204614271 G -> C LOC_Os12g08880-LOC_Os12g08890 intergenic_region ; MODIFIER silent_mutation Average:35.177; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204614271 NA 9.07E-09 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204614271 NA 9.20E-07 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204614271 NA 1.78E-06 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204614271 NA 1.60E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204614271 NA 1.17E-07 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204614271 5.47E-08 1.78E-14 mr1850_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251