\
| Variant ID: vg1204610850 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 4610850 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, A: 0.04, others allele: 0.00, population size: 222. )
GTGGTCCTTCAGATTGTGCATGATACCAACCCTTCATTGGAGGCAAGTGCATGACGAACTAAGTGTGTGATTGATGGATTGTTTGCTCTATCTATTTATT[A/T]
CCGATATATTTCTATGTGACATGTGACCGCTTATATTCATATTGTTGTTCGCGCCATTTAGGTTTTCATGTTTATCCTATGTTTACGATATTATTCTTGT
ACAAGAATAATATCGTAAACATAGGATAAACATGAAAACCTAAATGGCGCGAACAACAATATGAATATAAGCGGTCACATGTCACATAGAAATATATCGG[T/A]
AATAAATAGATAGAGCAAACAATCCATCAATCACACACTTAGTTCGTCATGCACTTGCCTCCAATGAAGGGTTGGTATCATGCACAATCTGAAGGACCAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.30% | 35.50% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 96.50% | 3.30% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 12.40% | 87.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 58.00% | 42.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.00% | 1.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 95.50% | 4.10% | 0.43% | 0.00% | NA |
| Indica III | 913 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.80% | 6.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 5.10% | 94.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 8.70% | 91.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 43.60% | 56.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 33.30% | 63.30% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1204610850 | A -> T | LOC_Os12g08880-LOC_Os12g08890 | intergenic_region ; MODIFIER | silent_mutation | Average:12.648; most accessible tissue: Minghui63 flag leaf, score: 17.021 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1204610850 | NA | 3.24E-06 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204610850 | NA | 2.81E-06 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204610850 | 5.58E-07 | NA | mr1679 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204610850 | 1.03E-06 | 7.73E-10 | mr1679 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204610850 | 3.51E-08 | NA | mr1691 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204610850 | 3.10E-09 | 5.38E-12 | mr1691 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204610850 | 1.93E-07 | NA | mr1693 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204610850 | 5.89E-09 | 3.53E-15 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204610850 | 8.49E-08 | 9.46E-10 | mr1720 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204610850 | NA | 3.81E-06 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204610850 | NA | 7.77E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204610850 | NA | 8.34E-06 | mr1123_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204610850 | NA | 1.88E-06 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204610850 | NA | 3.11E-06 | mr1594_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204610850 | NA | 1.23E-06 | mr1679_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204610850 | NA | 1.97E-09 | mr1691_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204610850 | NA | 5.57E-08 | mr1720_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |