\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204609935:

Variant ID: vg1204609935 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4609935
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCCAACTTCATAGCTTGGATCAAAAAGCGAAATAGAAAAACGGAACGAGGAGGAGGAGAGGAGTAAAAGGAGGGGTTAGATCAGAGTCTCCCCTATTGT[C/T]
TCCTCACAAGTTCTCTAAAGAAATCCTAAGTTAGGCTTTTCCTGTCGTCATATCAGTTGTTCTAGGGTGGTTTTAGTGGTTTAATTCGTGGATAAGGAAG

Reverse complement sequence

CTTCCTTATCCACGAATTAAACCACTAAAACCACCCTAGAACAACTGATATGACGACAGGAAAAGCCTAACTTAGGATTTCTTTAGAGAACTTGTGAGGA[G/A]
ACAATAGGGGAGACTCTGATCTAACCCCTCCTTTTACTCCTCTCCTCCTCCTCGTTCCGTTTTTCTATTTCGCTTTTTGATCCAAGCTATGAAGTTGGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.70% 1.80% 0.51% 0.00% NA
All Indica  2759 99.90% 0.00% 0.07% 0.00% NA
All Japonica  1512 93.20% 5.40% 1.39% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.00% 0.13% 0.00% NA
Temperate Japonica  767 98.00% 1.60% 0.39% 0.00% NA
Tropical Japonica  504 85.70% 11.30% 2.98% 0.00% NA
Japonica Intermediate  241 93.40% 5.40% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 3.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204609935 C -> T LOC_Os12g08880-LOC_Os12g08890 intergenic_region ; MODIFIER silent_mutation Average:49.459; most accessible tissue: Zhenshan97 flag leaf, score: 76.925 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204609935 NA 2.64E-10 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204609935 NA 4.11E-11 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204609935 NA 1.04E-11 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204609935 NA 6.34E-12 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204609935 NA 6.45E-14 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204609935 NA 3.48E-13 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204609935 NA 7.01E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204609935 2.91E-08 1.71E-16 mr1390_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204609935 9.28E-07 1.92E-15 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251