\
| Variant ID: vg1204515146 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 4515146 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TGTTGTGTTATTTTTTAGAACTCCATATTGTTGTGTTGAGTTGAAATAAGGAACAAACAACTCTAAAGAGCATTTTTTTTTCATAACTGGAGTGGATAAA[G/T]
GTGTTACTGGTACAGAAAGGGCAATCCTTGCCCACTGATCTCTATCGGTTCGGTGTGAGCCAACAGGGATTGCCAATCTTTACCAGTTCATGGCGTTGGA
TCCAACGCCATGAACTGGTAAAGATTGGCAATCCCTGTTGGCTCACACCGAACCGATAGAGATCAGTGGGCAAGGATTGCCCTTTCTGTACCAGTAACAC[C/A]
TTTATCCACTCCAGTTATGAAAAAAAAATGCTCTTTAGAGTTGTTTGTTCCTTATTTCAACTCAACACAACAATATGGAGTTCTAAAAAATAACACAACA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.50% | 34.30% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 96.80% | 3.10% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 14.40% | 85.40% | 0.13% | 0.00% | NA |
| Aus | 269 | 63.20% | 36.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.90% | 3.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.70% | 5.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 4.80% | 95.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 14.30% | 85.50% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 45.20% | 54.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 95.80% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 36.70% | 58.90% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1204515146 | G -> T | LOC_Os12g08780.1 | downstream_gene_variant ; 527.0bp to feature; MODIFIER | silent_mutation | Average:44.36; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg1204515146 | G -> T | LOC_Os12g08770-LOC_Os12g08780 | intergenic_region ; MODIFIER | silent_mutation | Average:44.36; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1204515146 | 8.04E-06 | NA | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204515146 | NA | 9.07E-07 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204515146 | NA | 8.00E-07 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204515146 | NA | 6.14E-07 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204515146 | 7.86E-06 | NA | mr1247 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204515146 | NA | 6.08E-06 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204515146 | NA | 2.35E-07 | mr1691 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204515146 | NA | 9.27E-11 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204515146 | NA | 8.99E-06 | mr1720 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204515146 | NA | 6.64E-06 | mr1113_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204515146 | NA | 3.46E-06 | mr1114_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204515146 | NA | 1.09E-07 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204515146 | NA | 4.65E-16 | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204515146 | NA | 2.18E-07 | mr1118_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204515146 | NA | 2.51E-07 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204515146 | NA | 2.27E-06 | mr1120_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204515146 | NA | 1.79E-07 | mr1123_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204515146 | NA | 3.10E-06 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204515146 | NA | 2.46E-07 | mr1242_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204515146 | NA | 2.84E-06 | mr1247_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204515146 | NA | 4.53E-13 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204515146 | NA | 1.32E-08 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204515146 | 2.68E-06 | 2.68E-06 | mr1657_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204515146 | NA | 2.91E-07 | mr1679_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204515146 | NA | 1.14E-08 | mr1691_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204515146 | NA | 1.21E-08 | mr1720_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204515146 | NA | 5.93E-06 | mr1936_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |