\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204514412:

Variant ID: vg1204514412 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4514412
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.17, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


CCTATTAAAAGTTTATATATTGATCCTACCAAGTCCTTAAAAAACTCATAAAGATGGGCTTTCGGCTTTCGTCAATCCAGTATCATCAGTTACCCACATC[T/C]
AGAGTTCAAAATAAAATCTAGCTCTCTAATAGAATGTACAGTACCACTCTTTGACCATTGCATATCTCAACAGATTGTAATACCACCTTAGGCCAGGATC

Reverse complement sequence

GATCCTGGCCTAAGGTGGTATTACAATCTGTTGAGATATGCAATGGTCAAAGAGTGGTACTGTACATTCTATTAGAGAGCTAGATTTTATTTTGAACTCT[A/G]
GATGTGGGTAACTGATGATACTGGATTGACGAAAGCCGAAAGCCCATCTTTATGAGTTTTTTAAGGACTTGGTAGGATCAATATATAAACTTTTAATAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.00% 32.70% 0.30% 0.00% NA
All Indica  2759 97.20% 2.60% 0.14% 0.00% NA
All Japonica  1512 18.30% 81.30% 0.40% 0.00% NA
Aus  269 63.90% 36.10% 0.00% 0.00% NA
Indica I  595 99.00% 1.00% 0.00% 0.00% NA
Indica II  465 96.10% 3.70% 0.22% 0.00% NA
Indica III  913 97.90% 2.00% 0.11% 0.00% NA
Indica Intermediate  786 95.80% 3.90% 0.25% 0.00% NA
Temperate Japonica  767 5.50% 94.30% 0.26% 0.00% NA
Tropical Japonica  504 23.40% 76.00% 0.60% 0.00% NA
Japonica Intermediate  241 48.50% 51.00% 0.41% 0.00% NA
VI/Aromatic  96 2.10% 96.90% 1.04% 0.00% NA
Intermediate  90 37.80% 58.90% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204514412 T -> C LOC_Os12g08780.1 downstream_gene_variant ; 1261.0bp to feature; MODIFIER silent_mutation Average:47.321; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg1204514412 T -> C LOC_Os12g08770-LOC_Os12g08780 intergenic_region ; MODIFIER silent_mutation Average:47.321; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204514412 NA 1.24E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204514412 NA 2.26E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204514412 NA 3.76E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204514412 NA 4.95E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204514412 NA 1.34E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204514412 NA 9.83E-06 mr1177_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204514412 NA 2.72E-11 mr1180_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204514412 NA 3.83E-11 mr1183_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204514412 NA 5.79E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251