\
| Variant ID: vg1204514412 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 4514412 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.17, others allele: 0.00, population size: 204. )
CCTATTAAAAGTTTATATATTGATCCTACCAAGTCCTTAAAAAACTCATAAAGATGGGCTTTCGGCTTTCGTCAATCCAGTATCATCAGTTACCCACATC[T/C]
AGAGTTCAAAATAAAATCTAGCTCTCTAATAGAATGTACAGTACCACTCTTTGACCATTGCATATCTCAACAGATTGTAATACCACCTTAGGCCAGGATC
GATCCTGGCCTAAGGTGGTATTACAATCTGTTGAGATATGCAATGGTCAAAGAGTGGTACTGTACATTCTATTAGAGAGCTAGATTTTATTTTGAACTCT[A/G]
GATGTGGGTAACTGATGATACTGGATTGACGAAAGCCGAAAGCCCATCTTTATGAGTTTTTTAAGGACTTGGTAGGATCAATATATAAACTTTTAATAGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.00% | 32.70% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 97.20% | 2.60% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 18.30% | 81.30% | 0.40% | 0.00% | NA |
| Aus | 269 | 63.90% | 36.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 97.90% | 2.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.80% | 3.90% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 5.50% | 94.30% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 23.40% | 76.00% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 48.50% | 51.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 96.90% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 58.90% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1204514412 | T -> C | LOC_Os12g08780.1 | downstream_gene_variant ; 1261.0bp to feature; MODIFIER | silent_mutation | Average:47.321; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg1204514412 | T -> C | LOC_Os12g08770-LOC_Os12g08780 | intergenic_region ; MODIFIER | silent_mutation | Average:47.321; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1204514412 | NA | 1.24E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204514412 | NA | 2.26E-06 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204514412 | NA | 3.76E-06 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204514412 | NA | 4.95E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204514412 | NA | 1.34E-06 | mr1063_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204514412 | NA | 9.83E-06 | mr1177_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204514412 | NA | 2.72E-11 | mr1180_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204514412 | NA | 3.83E-11 | mr1183_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204514412 | NA | 5.79E-08 | mr1794_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |