Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1204514412:

Variant ID: vg1204514412 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 4514412
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.17, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

CCTATTAAAAGTTTATATATTGATCCTACCAAGTCCTTAAAAAACTCATAAAGATGGGCTTTCGGCTTTCGTCAATCCAGTATCATCAGTTACCCACATC[T/C]
AGAGTTCAAAATAAAATCTAGCTCTCTAATAGAATGTACAGTACCACTCTTTGACCATTGCATATCTCAACAGATTGTAATACCACCTTAGGCCAGGATC

Reverse complement sequence

GATCCTGGCCTAAGGTGGTATTACAATCTGTTGAGATATGCAATGGTCAAAGAGTGGTACTGTACATTCTATTAGAGAGCTAGATTTTATTTTGAACTCT[A/G]
GATGTGGGTAACTGATGATACTGGATTGACGAAAGCCGAAAGCCCATCTTTATGAGTTTTTTAAGGACTTGGTAGGATCAATATATAAACTTTTAATAGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.00%	32.70%	0.30%	0.00%	NA
All Indica	2759	97.20%	2.60%	0.14%	0.00%	NA
All Japonica	1512	18.30%	81.30%	0.40%	0.00%	NA
Aus	269	63.90%	36.10%	0.00%	0.00%	NA
Indica I	595	99.00%	1.00%	0.00%	0.00%	NA
Indica II	465	96.10%	3.70%	0.22%	0.00%	NA
Indica III	913	97.90%	2.00%	0.11%	0.00%	NA
Indica Intermediate	786	95.80%	3.90%	0.25%	0.00%	NA
Temperate Japonica	767	5.50%	94.30%	0.26%	0.00%	NA
Tropical Japonica	504	23.40%	76.00%	0.60%	0.00%	NA
Japonica Intermediate	241	48.50%	51.00%	0.41%	0.00%	NA
VI/Aromatic	96	2.10%	96.90%	1.04%	0.00%	NA
Intermediate	90	37.80%	58.90%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1204514412	T -> C	LOC_Os12g08780.1	downstream_gene_variant ; 1261.0bp to feature; MODIFIER	silent_mutation	Average:47.321; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg1204514412	T -> C	LOC_Os12g08770-LOC_Os12g08780	intergenic_region ; MODIFIER	silent_mutation	Average:47.321; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1204514412	NA	1.24E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204514412	NA	2.26E-06	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204514412	NA	3.76E-06	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204514412	NA	4.95E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204514412	NA	1.34E-06	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204514412	NA	9.83E-06	mr1177_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204514412	NA	2.72E-11	mr1180_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204514412	NA	3.83E-11	mr1183_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204514412	NA	5.79E-08	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251